ID: 1161944545

View in Genome Browser
Species Human (GRCh38)
Location 19:7427147-7427169
Sequence GGCGCACACAGGATGTTTTA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 110
Summary {0: 1, 1: 0, 2: 4, 3: 15, 4: 90}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161944537_1161944545 16 Left 1161944537 19:7427108-7427130 CCATCTGGCCTTTTTGCTGTCGC 0: 1
1: 0
2: 2
3: 16
4: 186
Right 1161944545 19:7427147-7427169 GGCGCACACAGGATGTTTTAGGG 0: 1
1: 0
2: 4
3: 15
4: 90
1161944538_1161944545 8 Left 1161944538 19:7427116-7427138 CCTTTTTGCTGTCGCAGAACCTG 0: 1
1: 0
2: 0
3: 9
4: 169
Right 1161944545 19:7427147-7427169 GGCGCACACAGGATGTTTTAGGG 0: 1
1: 0
2: 4
3: 15
4: 90

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161944545 Original CRISPR GGCGCACACAGGATGTTTTA GGG Intronic
901228954 1:7631321-7631343 GGGGCTCACTGGATGTTTCATGG - Intronic
909175797 1:72357107-72357129 GAAGCAGACAGGATATTTTAAGG + Intergenic
910425866 1:87119704-87119726 GTGGCACACAGGATGATTCAAGG - Intronic
912599991 1:110920551-110920573 AGAGCACAGAGGATTTTTTATGG + Intergenic
914420299 1:147522652-147522674 GTCCCACAAAGGATGTTTCAGGG - Intergenic
918051924 1:180981040-180981062 GTGGAACACAGGATTTTTTAGGG + Intronic
919385497 1:196917921-196917943 GGTGGACACAACATGTTTTAGGG + Intronic
919602958 1:199645590-199645612 GGAGCACAAAGAAAGTTTTAGGG + Intergenic
1063792179 10:9464425-9464447 AGAGCACAAAGGATTTTTTAGGG + Intergenic
1065583087 10:27191318-27191340 GGAGCACAGAGGATTTTTTAGGG + Intergenic
1066602756 10:37125649-37125671 GGCGAACACAGAACTTTTTACGG + Intergenic
1072029114 10:91500136-91500158 AGTGCACACAGGAGGTGTTATGG + Intronic
1072499431 10:95998390-95998412 AGAGCACACAGGATGTTTAGGGG - Intronic
1074357469 10:112799016-112799038 GGCGCGCACAGGCTGGTTTCTGG + Intronic
1078882418 11:15465170-15465192 GGGGCACACAGGATGATTGAGGG + Intergenic
1078919648 11:15817648-15817670 GAACCACACAGGATGTTTCAGGG + Intergenic
1086266214 11:85001626-85001648 AGAGCACAGAGGATTTTTTAAGG + Intronic
1086478263 11:87203330-87203352 GGAGCACAGAGGATTTTTGAGGG - Intronic
1087173640 11:95076032-95076054 GGAACACAGAGGATGTTTTAGGG - Intergenic
1088117690 11:106331532-106331554 GGAGCAAACAGGATGTTATAGGG - Intergenic
1091315072 11:134608842-134608864 GGAGCACACAGGGTGATTGATGG - Intergenic
1092959734 12:13584824-13584846 GTCACACACAGGATGACTTAAGG - Intronic
1094215323 12:27934829-27934851 GGAGCACAGAGGATTTTTTAGGG + Intergenic
1102658675 12:114505691-114505713 AGAGCACACAGAATGTTGTAAGG - Intergenic
1103048933 12:117762381-117762403 GGCACTCACAGGATGTTTACTGG - Intronic
1104739498 12:131162960-131162982 GGCACACACAGGTTGTTTACAGG - Intergenic
1107732599 13:43363653-43363675 TGCCAACACAGGATGATTTAAGG + Intronic
1110615077 13:77532555-77532577 AGCACACAAAGGATTTTTTAGGG + Intergenic
1110724131 13:78800134-78800156 GGAGCACAGAGGATTTTTTAGGG - Intergenic
1111962422 13:94825962-94825984 GGGGCACACAGGAGTTTTTAAGG + Intergenic
1116834323 14:49754848-49754870 AGAGCACAGAGGATTTTTTAGGG - Intergenic
1123631786 15:22266170-22266192 AGGGCACCCAGGACGTTTTAAGG + Intergenic
1126525094 15:49644994-49645016 GTGGGACACATGATGTTTTATGG + Exonic
1128814533 15:70597961-70597983 GGCGCACACTGGCTCTTTAAAGG - Intergenic
1131417968 15:92277335-92277357 TGCCCACACATGATGTTCTATGG - Intergenic
1137638087 16:50004873-50004895 GGCTCACAGGGGCTGTTTTATGG - Intergenic
1140701049 16:77581873-77581895 GGGGCAATCAGCATGTTTTAAGG + Intergenic
1141971207 16:87484238-87484260 AGGGCACCCAGGACGTTTTAAGG - Intronic
1146482660 17:33217555-33217577 GGTGGACACAGAATGTTTAAAGG - Intronic
1147950714 17:44106209-44106231 GGGGGACACAGGAGGTTGTATGG + Intronic
1157146547 18:45168908-45168930 GGTGCATAAAGGGTGTTTTATGG + Intergenic
1158278547 18:55795176-55795198 GGGGCACACAGGGTGTTAAAAGG + Intergenic
1161027327 19:2042617-2042639 TGCTCACAGAGGATGTTTTCCGG + Exonic
1161944545 19:7427147-7427169 GGCGCACACAGGATGTTTTAGGG + Intronic
1164390296 19:27813978-27814000 CGTGCACACAGGATCTTTAAAGG + Intergenic
1166099196 19:40560931-40560953 GGATCACACAGAAGGTTTTAGGG + Intronic
1166177479 19:41085156-41085178 GGAGCACACAGGGTGATTGAGGG + Intergenic
1167467100 19:49656069-49656091 GGCTCACACAGGATGTTTAATGG - Intronic
1167785459 19:51632103-51632125 GGCACACATAGGATGATTTTTGG - Intronic
1168188925 19:54724430-54724452 GCAGCACACAGGATGTTGTGAGG - Intergenic
925966220 2:9069012-9069034 GAAGCACAAAGGATGTTTTTAGG - Intergenic
927602275 2:24454528-24454550 GTAGGACAAAGGATGTTTTAAGG - Intergenic
928211287 2:29325776-29325798 GCATCACACAGGATGTTGTAAGG + Intronic
933213441 2:79597918-79597940 GGAGCACAAAGGATTTTTAAAGG - Intronic
937976699 2:127586854-127586876 GGAGCTCCCTGGATGTTTTAAGG - Intronic
943263324 2:185694396-185694418 AGGGCACACAGGCTATTTTAAGG - Intergenic
944006444 2:194913866-194913888 GAAGCACATAGGATTTTTTAAGG - Intergenic
944423781 2:199558034-199558056 GGCCTACACGGGATGTTTTTAGG + Intergenic
1169811686 20:9615195-9615217 AGAGCACAGAGGATTTTTTAGGG + Intronic
1171151771 20:22833966-22833988 GGAGCACAGAGCATTTTTTAGGG + Intergenic
1174578627 20:51555293-51555315 GGCCCACATAGGATCTTGTAAGG - Intronic
1178449865 21:32688086-32688108 CGCCCACAGAGGAAGTTTTAAGG + Intronic
1178475371 21:32933062-32933084 GGGGCAGACCAGATGTTTTAAGG + Intergenic
1179089383 21:38250428-38250450 GGTACACACTGCATGTTTTATGG - Intronic
1180015345 21:45078691-45078713 GGAGCACACAGGCTGTGGTAAGG + Intronic
1180728450 22:17963323-17963345 GCTGGACACAGGATGTTTAAAGG + Intronic
1182375573 22:29845151-29845173 GGCACATACATGATGTTTTGAGG + Intergenic
1182741442 22:32570854-32570876 GTGGCCCACAGGATGATTTAGGG + Intronic
1183059710 22:35328636-35328658 GGAGCCCACAGGATGTTGAAAGG + Intronic
949982981 3:9514631-9514653 AGAGCACAGAGGATTTTTTAGGG - Intronic
964214223 3:154261356-154261378 AGAGCACAGAGGATTTTTTAGGG + Intergenic
968693609 4:2009222-2009244 GGCGCCGCCATGATGTTTTACGG - Exonic
968917014 4:3500970-3500992 GGTGCAAACAGGAAGTTTTCAGG + Intronic
969170722 4:5360573-5360595 GAGGTACACAGCATGTTTTATGG + Intronic
969697406 4:8742367-8742389 GGGGCACAGAGGATGGTTTTGGG + Intergenic
975124516 4:70766858-70766880 GGAGCACAGAGGATTTTTTAGGG - Intronic
976455806 4:85246036-85246058 GTAGCACACAGGATGGTTAAAGG - Intergenic
984481709 4:180311939-180311961 GGCCCACACAGGATGGTGCAGGG + Intergenic
987042433 5:14075632-14075654 GGAAAACACAGGATGTTTTAAGG + Intergenic
989611987 5:43302861-43302883 GCGGCACAGAGGATGTTTAACGG + Intronic
993930422 5:93932280-93932302 GGCACACACATGATGTTTAAAGG - Intronic
997098329 5:130939192-130939214 GGAGGACACAAGATGTTTTAGGG + Intergenic
1000209547 5:159097234-159097256 AGCGCCCACTGGATGTTTTGGGG - Intronic
1004588124 6:17022453-17022475 AGAGCACAGAGGATGTTTTGAGG - Intergenic
1007673286 6:43574995-43575017 AGCCCACACACGTTGTTTTATGG + Intronic
1011874989 6:91948319-91948341 AGAGCACACAGGATTTTTTAGGG + Intergenic
1018226836 6:161636793-161636815 GGTCCACACAGGATGTTTACAGG + Intronic
1021590869 7:22260147-22260169 GGAGCACACAGGATTTTTTAGGG + Intronic
1024019878 7:45358967-45358989 GAAGCACAGAGGATTTTTTAGGG + Intergenic
1028254086 7:88570758-88570780 GGAGCACAGAGGATGTATTAGGG - Intergenic
1028816431 7:95151485-95151507 GGAGCACAGAGGATTTTTTTAGG + Intronic
1033394691 7:140962389-140962411 GGTGCACACAGGAGGCTTTGGGG - Intergenic
1034927749 7:155136306-155136328 GGAGCACAGAGGATGTTTTAGGG + Intergenic
1037759344 8:21731612-21731634 GGCGCACAAAGGATTTTCTTAGG - Intronic
1039242197 8:35569257-35569279 GGCACACAAAAGAGGTTTTATGG - Intronic
1039624121 8:39030223-39030245 GGAGCACAGAGGATTTTTTAAGG - Intronic
1040977488 8:53210235-53210257 GACGCACAAGGGATTTTTTAGGG - Intergenic
1043320307 8:78976281-78976303 AGAGCACAGAGGATTTTTTAGGG - Intergenic
1046877632 8:119274011-119274033 GGACCACAGAGGATATTTTAGGG + Intergenic
1047075302 8:121394353-121394375 AGCGCACACAGGAGATATTATGG + Intergenic
1053187516 9:36030515-36030537 AGAGCACAGAGGATTTTTTAGGG - Intergenic
1056379386 9:86043410-86043432 AGACCAGACAGGATGTTTTAAGG + Intronic
1057392836 9:94653726-94653748 GGCACACTCAGGATGATTTCAGG + Intergenic
1057777721 9:98024499-98024521 AGAGCACACAGGAAGTTTCAGGG - Intergenic
1186280230 X:7985116-7985138 GGCGCACAGAGAATTTTTTAGGG + Intergenic
1191164419 X:57372686-57372708 GGCTAACACAGTAAGTTTTATGG - Intronic
1192213317 X:69141374-69141396 GGCGCACACAGTGTGGTGTATGG - Intergenic
1195028803 X:100906379-100906401 GGAGCACAGAGGATTTTTCAGGG - Intergenic
1195138845 X:101938427-101938449 GGCCCACACAGGATTTTTTATGG - Intergenic
1197192067 X:123658716-123658738 AGAGCACAGAGGATTTTTTAGGG + Intronic