ID: 1161945917

View in Genome Browser
Species Human (GRCh38)
Location 19:7436684-7436706
Sequence GCCAGGATGCTGCTGGGCAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 391
Summary {0: 1, 1: 0, 2: 2, 3: 38, 4: 350}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161945910_1161945917 2 Left 1161945910 19:7436659-7436681 CCACAAGCAACCATCTGTCAGCC 0: 1
1: 0
2: 0
3: 9
4: 241
Right 1161945917 19:7436684-7436706 GCCAGGATGCTGCTGGGCAAAGG 0: 1
1: 0
2: 2
3: 38
4: 350
1161945912_1161945917 -8 Left 1161945912 19:7436669-7436691 CCATCTGTCAGCCCTGCCAGGAT 0: 1
1: 0
2: 2
3: 23
4: 278
Right 1161945917 19:7436684-7436706 GCCAGGATGCTGCTGGGCAAAGG 0: 1
1: 0
2: 2
3: 38
4: 350
1161945909_1161945917 9 Left 1161945909 19:7436652-7436674 CCTCAGTCCACAAGCAACCATCT 0: 1
1: 0
2: 1
3: 21
4: 180
Right 1161945917 19:7436684-7436706 GCCAGGATGCTGCTGGGCAAAGG 0: 1
1: 0
2: 2
3: 38
4: 350

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161945917 Original CRISPR GCCAGGATGCTGCTGGGCAA AGG Intronic
901194433 1:7432578-7432600 GCCAGGATGCTGAGGGGCCAGGG + Intronic
901313927 1:8292706-8292728 CCCAGGCTGCTGCAGTGCAATGG + Intergenic
903594275 1:24482290-24482312 GCCAGGATGGGGGTGGGGAAGGG - Intergenic
903755443 1:25657366-25657388 GCCAGGATGCAGCTGGGTGGTGG + Intronic
904461786 1:30685079-30685101 GCCAAGAGGCTGCTGGGCCCGGG - Intergenic
905518684 1:38580881-38580903 GACAGAATGCTGCTGGGCTAAGG + Intergenic
907517860 1:55004665-55004687 GCCAGGCTTGTGCTGGGCACTGG + Intronic
907736869 1:57121778-57121800 GCTAGGAAGGTGGTGGGCAAGGG + Intronic
908158988 1:61387418-61387440 GGCAGAATGTTGCTGGGCGAAGG - Intronic
910654547 1:89606403-89606425 GCCAGGATGCCTAAGGGCAAAGG + Intergenic
914370796 1:147022715-147022737 GCCAGGGGGCTGGTGGGGAATGG + Intergenic
915092523 1:153436508-153436530 GCCAGCATCCAGCTGGGCACTGG - Intergenic
915276457 1:154792164-154792186 GCCACGATGCTGCTTTGCAGAGG + Intronic
915496146 1:156284153-156284175 GTTGGGATGCAGCTGGGCAAAGG - Intronic
915927919 1:160038303-160038325 GGCAGGACGCTGCTGGGGATGGG + Exonic
916679225 1:167089147-167089169 GGCAGCCTGCTGCTGGGGAAGGG - Intronic
917041318 1:170809269-170809291 GCTGGGATGGTGCTGGGCCAGGG + Intergenic
920203852 1:204277285-204277307 GCCAGAATGCTACTGGTCAGAGG + Intronic
920249743 1:204615637-204615659 GCCAGGGTGCCGCAGGGAAAGGG + Intergenic
920704907 1:208243872-208243894 GCCGGGCTGCTGCGGGGCGACGG - Exonic
922467676 1:225855492-225855514 GCCAGGATGCCTCTGGGCTCTGG - Intronic
1062947502 10:1472603-1472625 ACCAGGAGGCTGCTGGGCCATGG - Intronic
1064137162 10:12761093-12761115 TGCAGGATGCTGCTGAGCGATGG - Intronic
1064252602 10:13718287-13718309 GTCAGGCTGCTGCTGGGAGAAGG + Intronic
1066454857 10:35564351-35564373 GACATGAAGCTGCTGGGGAAAGG - Intronic
1066466326 10:35653566-35653588 GCCAGGAGACTGCTGGGAAGAGG - Intergenic
1067055638 10:43048361-43048383 CACAGGATGATGCTGGGCACAGG + Intergenic
1067164313 10:43852979-43853001 TCAGGGAGGCTGCTGGGCAATGG + Intergenic
1070007182 10:72435813-72435835 GCAAGGCTGCAGCTGGGCAGGGG + Intronic
1070286168 10:75085464-75085486 GCAAGGACTCTGCTGGGCAATGG + Intergenic
1070450805 10:76555179-76555201 GCCAGGATCCTGCTGGTCTGTGG - Intronic
1070664534 10:78333813-78333835 GCCAGGAGGCAGCTGGGCTCAGG + Intergenic
1070806130 10:79271809-79271831 GCCTGGAGCCTGCTGGGCAGAGG + Intronic
1071491753 10:86140990-86141012 ACCAGGCTGCTGATGGACAAGGG - Intronic
1071880987 10:89898016-89898038 TCCAGGCTGGTGCTGGGGAATGG + Intergenic
1073176327 10:101559721-101559743 GCCAGGCTGGTACTGGGCAAGGG - Intergenic
1073379650 10:103068080-103068102 ACCAAGATGATGCTGGGCGATGG - Intronic
1074678371 10:115878806-115878828 ACCATGTTGCTGCTGGGCGAAGG - Intronic
1074831680 10:117254086-117254108 GCCAGGTCGCTGCAGGGCATCGG + Exonic
1076178472 10:128386939-128386961 GCCTGCATGTTCCTGGGCAAGGG - Intergenic
1076496899 10:130903530-130903552 GCCAGGAAGCTGCTGGTCCCAGG - Intergenic
1076636718 10:131885936-131885958 GCCAGGCTGGGGCTGGGCACTGG - Intergenic
1076890486 10:133280880-133280902 GCCAGGGCGGTGCTGGGCAGGGG + Intronic
1076890522 10:133281004-133281026 GCCAGGGCGGTGCTGGGCAGGGG + Intronic
1076890579 10:133281198-133281220 GCCAGGGCGGTGCTGGGCAGGGG + Intronic
1078311404 11:10246931-10246953 CCCAGCATGGTGCTGGGCATGGG + Intronic
1079173229 11:18115919-18115941 CCCAGGATGCAGCTGAGCAGAGG - Intronic
1080652593 11:34234484-34234506 CCCAGGGTGAGGCTGGGCAAGGG + Intronic
1080682222 11:34487461-34487483 GCCAGGATGCTCCTGCCCAGAGG - Intronic
1081659774 11:44880909-44880931 TCCAGAGGGCTGCTGGGCAAAGG + Intronic
1081691074 11:45079074-45079096 GCCAGGCTGCTGCAGGGGAGAGG + Intergenic
1081756710 11:45549864-45549886 AGCAGGATGTTGGTGGGCAAGGG - Intergenic
1083159001 11:60842939-60842961 TCCAGGCTGCAGCAGGGCAAAGG - Intronic
1083813152 11:65116761-65116783 GCCCGCATCCTGCTGGGCGAGGG - Exonic
1083935077 11:65865797-65865819 GCCAGGAGGCTGGGGGGCAGGGG - Exonic
1084557163 11:69882006-69882028 GCCAGGCTGCTGCTGGGGACGGG + Intergenic
1085507715 11:77069649-77069671 CCCAGGAGGCTGCTGGGGAGGGG - Intronic
1086070137 11:82790765-82790787 GCCACGATGCTGCAGAGCACTGG + Intergenic
1087252974 11:95924113-95924135 GCCTGTAGGCTGCTGGGCAGCGG + Exonic
1089313204 11:117573626-117573648 GACAGGAGGCTGCAGGGCAGAGG - Intronic
1089604500 11:119634116-119634138 GCCAGGCTGCTTCTGTGCAATGG + Intronic
1089635423 11:119808653-119808675 GTGAGGATGCTGCTGGGACAGGG + Intergenic
1090071592 11:123549027-123549049 GGCAGGAAGATGCTGGGGAAGGG + Intronic
1090498105 11:127234295-127234317 GGTAGGAAGCTGCTGGGCACAGG + Intergenic
1090959528 11:131543749-131543771 ACCAGGATGATGCAGGGCTACGG - Intronic
1091295946 11:134474131-134474153 GCCTGGACTCTGCTGGGCAGTGG + Intergenic
1091945682 12:4539107-4539129 GCTAGGATACTTCTGAGCAACGG - Intronic
1092958089 12:13568874-13568896 GCCAGGATGATACTGGGGAGTGG + Intronic
1093447565 12:19277938-19277960 GACAGGCAGCTGCTGGCCAATGG + Intronic
1093866859 12:24237938-24237960 GACAGGACCCTGCTGGGCCATGG + Intergenic
1094636140 12:32228511-32228533 TACAGGAAGGTGCTGGGCAAAGG + Intronic
1096523556 12:52197701-52197723 CCCAGCATGCTGCTTGGCCAGGG - Intergenic
1098099795 12:67002928-67002950 TCCAAGGTGCTGCTGGGCAGGGG - Intergenic
1098914590 12:76244052-76244074 TCCAGGCTGCAGCTGGGCACAGG - Intergenic
1101541875 12:105672680-105672702 GCCAGGGCGCTGCTGAACAAGGG - Intergenic
1101866648 12:108525157-108525179 GCCCGTATGCTGCTGGTCACAGG + Intronic
1101874946 12:108591773-108591795 GCCAGGATGGTGGAGGGCAGGGG - Exonic
1101926691 12:108977524-108977546 GCCAGGATGCTGCTTGGTGCTGG + Intronic
1102181825 12:110918430-110918452 GGCACGAGGCTGCTGGGCATAGG + Intronic
1103171344 12:118822746-118822768 ACCAGCATGCTGCTGGCTAAAGG + Intergenic
1104635711 12:130436927-130436949 GGCAGGATGCGGCTGGGTGAGGG + Exonic
1106013629 13:25847906-25847928 CCTGGGGTGCTGCTGGGCAAAGG - Intronic
1106419498 13:29573875-29573897 GCTAGAAAGGTGCTGGGCAAAGG - Intronic
1106816878 13:33418362-33418384 GCAAGGCTGCAGCTGGGCAAGGG + Intergenic
1107048286 13:36017884-36017906 GGGAGGATGGTGCTGGGCAGAGG - Intronic
1112061335 13:95742321-95742343 GGCAGGATGCTGCCTGGTAAGGG + Intronic
1112640143 13:101264497-101264519 TCCAGGTTGCTGCTGGTCCAGGG - Intronic
1113247358 13:108412514-108412536 GGCAGGACACTGCTGGGAAATGG - Intergenic
1113634268 13:111909243-111909265 GCCTGGCTGCTGCTGTGCCAGGG - Intergenic
1113769327 13:112898403-112898425 CCCACGCTGCTGCTGGGTAAAGG + Intronic
1116375883 14:44200307-44200329 GCAAGGATGATGCTGTTCAAAGG + Intergenic
1119520509 14:75281097-75281119 GCCTGGATGATGCTGGGAACAGG - Exonic
1119850879 14:77865855-77865877 GCAAGCTTGCTGCAGGGCAAGGG + Intronic
1119863932 14:77957352-77957374 GCCTGGTTGCTGCTGGATAATGG + Intergenic
1120706485 14:87751317-87751339 GCCAGGATGCTGTGGGACAGAGG + Intergenic
1121222645 14:92298349-92298371 GCCATGAAGCTGCTGGCCCAGGG - Intergenic
1121407381 14:93727479-93727501 GCCAGAATGGTGCTGGGGGATGG + Intronic
1121510493 14:94509557-94509579 GCCAGGCTGATCCTGGGAAAGGG - Intronic
1121629401 14:95411643-95411665 GGCAGGATCCCGCTGGGCTATGG + Intronic
1121665109 14:95666232-95666254 GCCAGGAGGATGCAGGGAAATGG + Intergenic
1121686647 14:95840337-95840359 GGCAGGGTGATGCTGGCCAAAGG + Intergenic
1121928055 14:97947333-97947355 GCCTGGATGTGGCTGGGCAAGGG - Intronic
1122261019 14:100523085-100523107 GCCAGGATGTTGCTGGGAGCCGG + Intronic
1122302335 14:100738366-100738388 GCCAGGAGGCCGCAGGGCTAAGG + Intergenic
1122357225 14:101131030-101131052 GCCAGGAGGCTCCTGGGCTCTGG - Intergenic
1122811522 14:104291729-104291751 GCCTGGAGGGTGCTGGGCCAAGG - Intergenic
1123053391 14:105558700-105558722 CCCAGGAGGCTGCCGGGCCAGGG + Intergenic
1123077968 14:105679114-105679136 CCCAGGAGGCTGCCGGGCCAGGG + Intergenic
1127867910 15:63047024-63047046 GCCAGGAAACTGCTGGACACTGG - Intronic
1128082704 15:64865818-64865840 GCCAGGAAGCACCTGGGCTAAGG + Exonic
1128245125 15:66127793-66127815 GGCAGGGTGTTGCTGGGGAAGGG - Intronic
1128611212 15:69074904-69074926 GCCAGTGTGCTGCAAGGCAAGGG - Intergenic
1128705715 15:69836338-69836360 GGAAGGATGCTGCTGGCCACGGG - Intergenic
1129205618 15:74035578-74035600 GGCAGGATGTTCCTGGGCATTGG - Intronic
1129245534 15:74276670-74276692 GCCAGGAGGCTGGAGGGCACAGG - Intronic
1129249330 15:74299990-74300012 GCCATGATCCTTCTGGGCACTGG - Intronic
1129666361 15:77581792-77581814 TCCAGGCTGCTGCTTGGCAAGGG - Intergenic
1130383648 15:83393083-83393105 GACAGGCTGCTCCTAGGCAAAGG - Intergenic
1130892073 15:88141806-88141828 CCAAGGATGCTGCCAGGCAAAGG + Intronic
1130910156 15:88265255-88265277 TCCAGCATGAGGCTGGGCAAGGG - Intergenic
1131173155 15:90192381-90192403 GCCTGCATGCAGCTGGGCAGAGG + Intronic
1131681446 15:94728126-94728148 TCTGGTATGCTGCTGGGCAAAGG - Intergenic
1132830772 16:1926987-1927009 GCCAGGAGGCGGCTGGGGAGGGG - Intergenic
1132862424 16:2078185-2078207 GCTAGGATCCTGCAGGGCATGGG + Intronic
1133059209 16:3163573-3163595 GCGAGGCTGCTGCTGGGCCCTGG + Intergenic
1133207853 16:4244526-4244548 GACAAGATGGTGCTGGCCAAGGG + Intergenic
1133220621 16:4317700-4317722 GCCAGGCTGGAGCTTGGCAAAGG - Intronic
1133403302 16:5504315-5504337 GCCAGGAGCCTGCTGGGCCTCGG + Intergenic
1135194289 16:20381737-20381759 GCCAGGATGAAGCTGGGACAGGG - Intronic
1135651039 16:24206824-24206846 TCCAGCATGCTGCTCGGCAGAGG + Intronic
1135691258 16:24539695-24539717 GCCCGCAAGCTGCTGGGCAGCGG - Intronic
1136412048 16:30083275-30083297 GCCAGGAGTGTGCTGGGCAGTGG + Intronic
1136751197 16:32637724-32637746 GCCAGGATGCTGACGGGGCAGGG + Intergenic
1138461019 16:57147662-57147684 GACATGCTGCTGCTGGGCACTGG - Exonic
1138587764 16:57982391-57982413 GTCAGTATGATGGTGGGCAATGG - Intronic
1140148241 16:72333167-72333189 GGCAGGATGCTGGTGGGCACAGG + Intergenic
1140338269 16:74132215-74132237 GCCAGAATGCTTCTGGTAAAAGG + Intergenic
1141298638 16:82792801-82792823 GCCTGGATGCAGTTGGGCATTGG - Intronic
1141661165 16:85442368-85442390 GCCAGGATGCAGCAGGGAACAGG - Intergenic
1142140371 16:88470125-88470147 GCCAGCATTGTCCTGGGCAAAGG + Intronic
1142265140 16:89061023-89061045 GCTGGGCTGCTGCTGGGCAGGGG - Intergenic
1142396058 16:89832227-89832249 GCCACGGTGCTCCTCGGCAAAGG - Intronic
1203053331 16_KI270728v1_random:896979-897001 GCCAGGATGCTGACGGGGCAGGG + Intergenic
1142558722 17:797181-797203 TCCAGGCTGCGGCTGCGCAAGGG - Intergenic
1144490436 17:15704298-15704320 GCCAGCATGCTTCTTGGCCATGG + Intronic
1144910531 17:18677671-18677693 GCCAGCATGCTTCTTGGCCATGG - Intronic
1145975957 17:28984533-28984555 GCCAGGTGGGTGCTGAGCAATGG + Intronic
1147182308 17:38694052-38694074 GCCAGGAAGCTGCTGGAGAGTGG + Intergenic
1147218084 17:38912452-38912474 GCCAGGGTGCCGCTGGGCCAGGG + Intronic
1147938706 17:44029720-44029742 GCAAGGAGGCTGCTGGGTTAGGG - Intergenic
1148084848 17:44987882-44987904 GCCTGGATGCTGGGGGGCAGAGG + Intergenic
1148683349 17:49486999-49487021 GCCTGGAGGCTGGTGGGCACTGG - Intergenic
1149480031 17:56995946-56995968 GTCAGAATGTTGCTTGGCAAGGG - Intronic
1149786161 17:59437111-59437133 GCCAGGGCGTTGCTGGGCAAAGG + Intergenic
1149807148 17:59629333-59629355 ACCAGAATGCTGTTTGGCAAAGG + Intronic
1151217516 17:72587736-72587758 GCCAGGATGCTGCCTGGTCAGGG + Intergenic
1151715188 17:75827612-75827634 GCCAGGAGGCAGATGGGCCAGGG + Exonic
1151849272 17:76680686-76680708 CCCAGGATCCTGCTAGCCAAGGG + Intronic
1152474912 17:80511908-80511930 GACGGGATGCTCCTGGGCACAGG - Intergenic
1152589574 17:81204788-81204810 GCCAGGCTGGTGCTGGGCGTGGG - Intronic
1152827777 17:82478579-82478601 GCCTGGAGGCTACTGGGAAATGG - Intronic
1152885275 17:82845659-82845681 GAGAGGATGCTGCTGCGGAAGGG - Intronic
1153344960 18:4015399-4015421 GTGAGGAAGCTGCTGGGCCACGG + Intronic
1154297402 18:13162744-13162766 ACCAGGCTGCTGCTGTGGAAGGG - Intergenic
1154383890 18:13876177-13876199 GCCAGCATTCTGCTGGGAGAAGG - Intergenic
1157185955 18:45540245-45540267 AACAGGATGTGGCTGGGCAAGGG - Intronic
1157815779 18:50728677-50728699 GCTCTGATGCTGCTGGGCATTGG - Intronic
1159885139 18:73896607-73896629 GCCAAGGTGATGCTGGGAAAGGG - Intergenic
1161027634 19:2043932-2043954 ACCAGGATGCTGGAGTGCAATGG - Intronic
1161945917 19:7436684-7436706 GCCAGGATGCTGCTGGGCAAAGG + Intronic
1162734489 19:12738500-12738522 GCCAGGCTGCAGCTGAGTAATGG - Exonic
1162906967 19:13829917-13829939 GCCAGCATGGAGCTGGACAAAGG + Intronic
1163400115 19:17087072-17087094 GCCAGGCTGATGCTGGGCACAGG - Intronic
1165102575 19:33447563-33447585 GCCAGGCTGCTGGTGGGCACAGG - Intronic
1165390716 19:35537140-35537162 ACCAGCATGCTGCTGAGCATGGG - Intronic
1165403991 19:35618964-35618986 TGCAGGATGCAGCTGGGCATCGG + Exonic
1165422611 19:35729820-35729842 GCCTGGATGCGGCTGGGGAGAGG + Intronic
1165648532 19:37466585-37466607 CCCAGGCTGCTGGAGGGCAATGG - Intronic
1165908532 19:39208934-39208956 CCCAGGCTGCTGCAGTGCAATGG + Intergenic
1165947364 19:39452234-39452256 TCCAGGATGCTGCTGGTGCATGG + Intronic
1165994535 19:39834311-39834333 TCCAGGCTGCCGCTGCGCAAAGG + Intergenic
1166010184 19:39935709-39935731 GCCAGGCTGCAGGTGGGCACTGG + Intergenic
1166333457 19:42091643-42091665 GGCAGGATGCTGGAAGGCAAAGG - Intronic
1166660654 19:44644568-44644590 GCCAGCACGCTGCTGGGTTATGG - Intronic
1167661204 19:50796997-50797019 TCCAGCAGGCTGCTGGGAAAGGG - Intergenic
1168300352 19:55401502-55401524 GCCAGCATGCTTCTTGGCCATGG + Exonic
1168313995 19:55476147-55476169 ACCTGGTTCCTGCTGGGCAAAGG - Intergenic
925029838 2:641913-641935 GTGGGGATGCTGCTTGGCAACGG - Intergenic
925483710 2:4304637-4304659 GACAGCCTGCTGCTGAGCAATGG - Intergenic
926053072 2:9757090-9757112 GCCAACAAGCTGCTGGGCCAGGG + Intergenic
926224138 2:10955378-10955400 CCAAGGCTCCTGCTGGGCAATGG - Intergenic
927791406 2:26012724-26012746 GGCAGGATCCTGTTTGGCAAGGG - Intergenic
929758692 2:44788560-44788582 GCCAGGATTCATCTGGGCAGAGG - Intergenic
929927967 2:46230897-46230919 GACAGGATGTTGCTGGGGACAGG + Intergenic
930200488 2:48548132-48548154 GCCAGGATGTGGCTTGGCCAGGG + Intronic
931208942 2:60174318-60174340 GGAAGGATGCTGATGAGCAAAGG + Intergenic
931227321 2:60342782-60342804 GCCAGTATGCTGTAGGGCTAGGG + Intergenic
932075394 2:68657568-68657590 GCCAGCATGAATCTGGGCAATGG + Intergenic
932581133 2:72993341-72993363 GCCAGCCTGCCGCTTGGCAATGG + Intronic
932736202 2:74256403-74256425 GCCAGGAAGCTGGTGGCAAAGGG - Intronic
933384588 2:81593782-81593804 GAAAGGATGTTGCTAGGCAATGG + Intergenic
934681104 2:96284485-96284507 GACCTGAAGCTGCTGGGCAAAGG - Exonic
934935430 2:98461824-98461846 GCCAGCATGCAGCTGGACAATGG - Intronic
934967240 2:98733043-98733065 GCCAGCTTGCTACTTGGCAATGG - Intergenic
935028895 2:99303410-99303432 GCCAGCATGTTGCCTGGCAAAGG + Intronic
935124958 2:100214918-100214940 GCCTGGGGGCTGCTGTGCAAGGG + Intergenic
935131920 2:100266998-100267020 GCCAGCATGCTGCTGGGTCCTGG - Intergenic
935534199 2:104274028-104274050 CCCAGGATGCTGGTGGACCAGGG + Intergenic
936056791 2:109267838-109267860 GCCAGGCTCCTGCTGGACAGAGG + Intronic
936056947 2:109268502-109268524 GCCAGGCTCCTGCTGGACAGAGG - Intronic
936525224 2:113236684-113236706 TCCAGGGTGCTGTTGAGCAAGGG + Exonic
937083629 2:119157252-119157274 GAAAGGAGGCTGCAGGGCAAGGG + Intronic
937200946 2:120204227-120204249 GCCAGGCTCCTGCTGGTCAGAGG + Intergenic
937263622 2:120602009-120602031 GCAGGGAGGCTGCTGGGCAGGGG - Intergenic
937341836 2:121096167-121096189 TCCAGGGTGCTGCAGGGCAATGG + Intergenic
937844651 2:126566190-126566212 GGCAGGAGGCTGCTAGGGAAAGG + Intergenic
937910768 2:127074459-127074481 GCCAGGTGGCTGCTGGGCTGTGG - Intronic
938042386 2:128086288-128086310 TCCAGGTGGCTGCTGGGCAAAGG - Intergenic
938246089 2:129779112-129779134 GCAGGGGTGCTGCTGGGCACAGG + Intergenic
938308017 2:130267814-130267836 CCCAGGATGCTGTGGAGCAAGGG - Intergenic
939504313 2:143026920-143026942 GACAGGATACAGCTGGGCATCGG - Intronic
940832865 2:158487722-158487744 GCCAGAACTATGCTGGGCAATGG - Intronic
941094044 2:161215101-161215123 GCCAGGATGCTCAGGGGCCATGG + Intronic
942163822 2:173221291-173221313 GCCATGATGCTGATGGGCTTTGG + Intronic
944468805 2:200031328-200031350 GCCAGACTGCTGTTGGGAAATGG - Intergenic
945037638 2:205717578-205717600 CCCAGGCTGCTGCAGGGCACAGG + Intronic
946481603 2:220062220-220062242 CCAAGGATGCTGCTGTGCACAGG - Intergenic
947631420 2:231655820-231655842 GGCAGGATGCTGCTGTCCACTGG + Intergenic
947633214 2:231666711-231666733 GCCAAGATCCTGTTGGGCAGGGG - Intergenic
948124526 2:235555112-235555134 GCCTGGATGCTCCTAGGCAGAGG + Intronic
948395979 2:237645372-237645394 GCCAAGATGCTGCTGAGCCCTGG + Intronic
948515079 2:238498553-238498575 GCCAGGATGATCTAGGGCAATGG + Intergenic
948557293 2:238822133-238822155 GCCAGGATGCTTCTGGACCTGGG - Intergenic
948566446 2:238890203-238890225 GCCAGGAGCCTGCTGGGCTGGGG + Intronic
948748568 2:240113406-240113428 GCCCGGAGGCTGCTGGGCAAGGG + Intergenic
949009467 2:241670332-241670354 TCCAGGGAGCTGCTGGGCGAAGG + Intronic
1168892953 20:1306427-1306449 GACAGGATGGTGCAGGGCAGGGG - Exonic
1168936579 20:1670975-1670997 GCCAGGATGGTGCTGGCCTCTGG - Intergenic
1169274410 20:4224000-4224022 GCCAGGATGAGGCAGGGCAGAGG + Intronic
1169556521 20:6756995-6757017 GCCAATATTTTGCTGGGCAAAGG - Intergenic
1171349985 20:24494705-24494727 GCCAGCCTTCTGCAGGGCAAAGG - Intronic
1172046955 20:32087052-32087074 GCCAGAATACTCCTGGGCAATGG + Intronic
1173005384 20:39136037-39136059 GCCAGGATGATGCTGCCCAGAGG - Intergenic
1173192485 20:40887142-40887164 GCCAGGATGTTCCTGGGCATGGG - Intergenic
1174200789 20:48805121-48805143 GCCAGGAGGCTGGTGGGCACTGG - Intronic
1174286452 20:49477432-49477454 GCTAGGGTGCTCCTGGGAAAGGG + Intronic
1174292659 20:49519894-49519916 GAGAGGGTGCTGCTGGGCCAGGG - Intronic
1175758747 20:61546994-61547016 CTTAGGATGCTGCTGGGTAAAGG + Intronic
1175812491 20:61866022-61866044 GCCAGGATGCTGGTGGTGACAGG - Intronic
1175910493 20:62403031-62403053 GCCGAGATGCTTCTGGGGAAAGG - Intronic
1176263544 20:64196304-64196326 GCCTGGGTGGTGCTGGGCACAGG + Intronic
1176297042 21:5079288-5079310 GCCAGAAACCTGCTGGGCGAAGG + Intergenic
1176715817 21:10347941-10347963 AGCAGGAGGCTGCTGGGCCACGG - Intergenic
1178797442 21:35757903-35757925 GGCACGAAGCTGCTGGGCCAGGG - Intronic
1179090991 21:38265693-38265715 TCCAGGCTGCTGCTGGACAGAGG + Intronic
1179349245 21:40591975-40591997 GCCAGAAGGCAGCTGGGCCATGG - Intronic
1179859986 21:44182659-44182681 GCCAGAAACCTGCTGGGCGAAGG - Intergenic
1179997646 21:44981342-44981364 GCCAGGAAGGTGCTGGACAAAGG - Intergenic
1180167073 21:46035840-46035862 GGCAGGAGGCTGCACGGCAAAGG + Intergenic
1181083573 22:20429159-20429181 CGCAGGAAGCTGCTGGGAAATGG - Intronic
1181162680 22:20967323-20967345 GCCAGGGTGGGGCTGGGCTAGGG + Intronic
1181294360 22:21823526-21823548 GCCAGGTTGCTGGGTGGCAAAGG + Intronic
1181537782 22:23555668-23555690 GCCAGGACGCTGCTGGCTGAAGG + Intergenic
1181837186 22:25620373-25620395 GCCAGGAACATGTTGGGCAAGGG + Intronic
1181909645 22:26228484-26228506 ACCAGCATGGTGCTGGGCAATGG + Intronic
1182062442 22:27407663-27407685 GCCAGGGTCCTGGAGGGCAAAGG + Intergenic
1182308228 22:29386266-29386288 GCCAGGAAGCTGCTGAGCTGGGG + Intronic
1182368355 22:29793541-29793563 GCCAGGTCTCTGCTGGGCCAGGG - Intronic
1182782759 22:32881099-32881121 GCCAGGCTGCTGCTCGGGGAAGG + Intronic
1183738428 22:39656740-39656762 GCAAGGATGTGGCAGGGCAAAGG - Intronic
1184425794 22:44408584-44408606 GCCAGGATTCCGCAGGGCAGAGG + Intergenic
1184569368 22:45312025-45312047 GCCAGGACCATGCTGGGCTAGGG + Intronic
1185209944 22:49565134-49565156 GCCTGGATGCTGCTGGGCTATGG - Intronic
949684532 3:6553263-6553285 GCCAGGAACATGCTGGGCAAGGG - Intergenic
950538813 3:13597775-13597797 GCAGGGTTCCTGCTGGGCAAGGG + Intronic
950786476 3:15440681-15440703 GTGAGCATGCTGCTGGGCAGTGG - Exonic
953867300 3:46595456-46595478 GCCAGGGCGCTGCTGGACAATGG - Intronic
954424879 3:50438070-50438092 GCCAGGATGCTGGTGGGACAGGG + Intronic
954637137 3:52077134-52077156 GCCAGGCCCCTGCTGGCCAATGG + Intronic
957449893 3:80366286-80366308 TCCAGGAGGCTGTTGGGCACTGG + Intergenic
959905163 3:111703219-111703241 GCAGGGATGGTGCTGGGCACAGG + Intronic
960523416 3:118681744-118681766 GACAAGATGGTGCTGGCCAAGGG - Intergenic
961465142 3:127076846-127076868 GCCTGGAGGCTGCTGGAGAATGG - Intergenic
961484370 3:127206900-127206922 GCCAGGAAGCCACTTGGCAAGGG - Intergenic
961782601 3:129329568-129329590 GCCAGGTTTCTGCTGGGGCATGG - Intergenic
963274132 3:143313773-143313795 GCCTAGATGCTGCTGGGGAATGG + Intronic
964571043 3:158107128-158107150 GGCAGGATGATGCTGGGCGGTGG - Intronic
965020410 3:163221744-163221766 CCCAGGCTGCTGCTGTGCAATGG + Intergenic
968424559 4:513689-513711 GAAAGGATGCTGCTGGGCTGTGG + Intronic
968472145 4:787056-787078 GGCAGGATGCTGCGTGGCAGAGG + Intronic
968613548 4:1567565-1567587 CCCAGGACTCTGCTGGGCACAGG - Intergenic
970532128 4:16995604-16995626 TCCAGAATGATGCTGGGGAAGGG + Intergenic
971257915 4:25030843-25030865 GCCAGCATGCTGCTCGGCTGCGG - Exonic
971291791 4:25349117-25349139 GCCAGGATGGTGCTAAGCACTGG - Intronic
972732035 4:41804222-41804244 GGCAGGCTGCTGCGGGTCAAGGG - Intergenic
974240340 4:59238198-59238220 GGCAGGATGCTGGTGGGGATGGG + Intergenic
975899197 4:79129814-79129836 GACAGGGTGCTGGTGGGCACAGG + Intergenic
976094905 4:81498300-81498322 GGCGGGATGCTCCTGGGGAAAGG + Intronic
977507174 4:97916708-97916730 GTGAGGAAGCTGGTGGGCAAGGG - Intronic
978526911 4:109676961-109676983 CCCAGGATGCTGCTGCACACTGG - Intronic
981081380 4:140642400-140642422 GACAGGAAGGTGCTGGCCAAGGG - Intronic
981980333 4:150784423-150784445 GCCAGGATCATGTGGGGCAAGGG - Intronic
984828540 4:183950430-183950452 GGCAGGATGCTCCTGGGGCAGGG + Intronic
985711436 5:1431815-1431837 CCCAGGAGGCTGCTGGACATGGG + Intronic
986316080 5:6587331-6587353 CCCATGGTGCTGCTGGACAATGG - Intergenic
986320911 5:6632541-6632563 GCCAGGATGCTGGAGGTTAAAGG - Intronic
986357072 5:6938953-6938975 GCCAGGGCAATGCTGGGCAATGG - Intergenic
992499122 5:77324332-77324354 GCCAGCCTGGTGCTGGGCATGGG + Intronic
993178470 5:84518651-84518673 GGCAGGGTGCTGGTGGGCACAGG + Intergenic
996451385 5:123629229-123629251 GGCAGGGTGCTGGTGGGCATAGG - Intergenic
996789549 5:127277977-127277999 TCCAGGAGGCAGCTGGGCAGAGG + Intergenic
997980686 5:138465870-138465892 GAGATGATGCTGCTGAGCAACGG + Exonic
998486975 5:142511533-142511555 CCCAGGCTGCTGGTGGGGAAGGG + Intergenic
999609200 5:153351059-153351081 GCCAGAGAGGTGCTGGGCAAAGG - Intergenic
1002160526 5:177311802-177311824 ACCTGGATGTTGCTGGCCAAGGG + Exonic
1002782808 6:380024-380046 GACTGGATGCTGCTGGGCCAGGG - Intergenic
1002987313 6:2202971-2202993 GGCAGGATACTTCTGGCCAAAGG - Intronic
1004547214 6:16609465-16609487 GCATGGTTGCTGCTTGGCAATGG - Intronic
1006046344 6:31301929-31301951 GCTAGGAGGCTGTTGGGAAAAGG + Intronic
1007130140 6:39464643-39464665 GCCTGGATGCTAGTGGGCTAGGG + Intronic
1007462232 6:42027031-42027053 GCCAAGATGCTGATGGGTAAAGG + Intronic
1008159664 6:48061803-48061825 GCCAGTGTGCTGGTGGACAAGGG - Intronic
1010062685 6:71642794-71642816 GTGAGGATGCTGCTGAGCACAGG - Intergenic
1013341106 6:109216878-109216900 GTTAGGAAGCTTCTGGGCAATGG - Intergenic
1013592280 6:111629290-111629312 CCCAGGAAGCTGCTGGCCACTGG + Intergenic
1015578943 6:134702525-134702547 GCCCAGCTGCTGCTGGGGAATGG + Intergenic
1019669553 7:2270104-2270126 CCCAGGGAGCTGCTGGGCAGAGG + Intronic
1019794861 7:3042145-3042167 GCCAGGAAGCTGCTGTTTAACGG + Intronic
1020008198 7:4793212-4793234 TCCAGGAGGCAGCTGGGAAAAGG + Intronic
1021110267 7:16685962-16685984 TCGGGGATTCTGCTGGGCAATGG + Exonic
1022889179 7:34678156-34678178 GCCTGGATGGTGCTGGGGGATGG - Intronic
1023842400 7:44104687-44104709 GCCAGGAGGCAGCTGAGCAGGGG - Exonic
1024307170 7:47938634-47938656 GCCAGAATGCAGCTTGGAAATGG + Intronic
1024582379 7:50810366-50810388 GCGTGGATGCTGCTGGGCTGAGG - Intergenic
1027457665 7:78413721-78413743 GCCGGGAGGCTCTTGGGCAATGG + Intronic
1028252036 7:88547989-88548011 GACAAGATGGTGCTGGCCAAGGG - Intergenic
1029113971 7:98227971-98227993 GCCAGGATGCTGCCTGGCATAGG - Intronic
1029624821 7:101714126-101714148 GCCATGATGATGCTGGGCTGGGG - Intergenic
1029692514 7:102191658-102191680 CCCAGGGTGAGGCTGGGCAAAGG - Intronic
1033607687 7:142939561-142939583 GCACGGATCCTGCTGGGCACTGG + Exonic
1034104809 7:148481374-148481396 GGCAGGATGCTGGAGGCCAAAGG - Intergenic
1034480966 7:151320404-151320426 GCCAGGTTGCTCCTGAGCAGGGG + Intergenic
1034992283 7:155555392-155555414 GGCAGGAGGGTGCTGGGCAGGGG + Intergenic
1035189327 7:157152134-157152156 GCCAGAATGGGGGTGGGCAAAGG + Intronic
1036599127 8:10242930-10242952 ACCAGGATGCAGGTGGGCAAGGG - Intronic
1037443576 8:18942357-18942379 GCCTGGCTTCTGCTGGGCAATGG - Intronic
1038481891 8:27907530-27907552 TCCAGCATGCTGAAGGGCAAAGG - Intronic
1039408081 8:37329625-37329647 GCCAGGAGGCCCCTGGGCAAGGG + Intergenic
1039862761 8:41473123-41473145 GGCAGGATGCTGGAGGTCAAAGG + Intergenic
1039875839 8:41584932-41584954 GCCAGGATCCAACTGGCCAAAGG - Intronic
1043567132 8:81560950-81560972 GCCACAATGCTGCGGGGCAAAGG + Intergenic
1045739918 8:105345504-105345526 GAAATGATGCTGCTGTGCAAGGG - Intronic
1047495792 8:125407853-125407875 CCCAGGATGCTGATAGGCACAGG - Intergenic
1047760286 8:127949513-127949535 GAGAGGATGCTGATGGGCAGTGG - Intergenic
1048864776 8:138751854-138751876 GCCAGCAGGCTGCAGGGAAAGGG - Intronic
1049095772 8:140547342-140547364 GCCAGGACGGTGCTGGGCCCAGG + Intronic
1049420725 8:142515371-142515393 GCCTGGAACCTGCTGAGCAACGG + Intronic
1049622716 8:143605854-143605876 GCCAAGATGCTGCTGCACGAGGG - Exonic
1049989982 9:981580-981602 GCTGGGATGCTGCTGGGGACCGG + Intronic
1049992837 9:1006250-1006272 GAGAGGATTCTGCTGAGCAATGG - Intergenic
1050105106 9:2157418-2157440 CCTGGGATGCTGCTGGGCATGGG - Intronic
1051116225 9:13697631-13697653 GGCAGGATGCTGGTGGGGATGGG + Intergenic
1051363710 9:16304946-16304968 GCCAGCATGGTGCAAGGCAATGG + Intergenic
1051955939 9:22693413-22693435 GTCAGGATCCTGTTTGGCAAAGG - Intergenic
1057126275 9:92618504-92618526 CCAAGGATGCAGCTGGGCAATGG - Exonic
1057172960 9:92974933-92974955 CGCAGGATGCTGCATGGCAAGGG + Intronic
1057903004 9:98964140-98964162 CCCAGAATGGTGCAGGGCAAAGG - Intronic
1059275661 9:113094786-113094808 ACAAGGATGGTGCAGGGCAATGG + Intergenic
1059326767 9:113508465-113508487 CCCAGGAGGCTGCTGGACACGGG - Intronic
1059343251 9:113611605-113611627 CCCAGCAGGCTGCTGGGCAGAGG + Intergenic
1059430306 9:114245974-114245996 GCATGGAGGGTGCTGGGCAAAGG - Intronic
1060219548 9:121757125-121757147 CCAAGGATGCTGCTGTGCACGGG - Exonic
1060591588 9:124820469-124820491 GCCAGGAGGGTGATGGGCAGGGG - Intergenic
1060773309 9:126348307-126348329 GCCAGGGTGCGGCAGGACAAAGG - Intronic
1060793431 9:126500254-126500276 GCCAGGTTCCTGCAGGGCAGTGG - Intronic
1062059235 9:134486116-134486138 GCCCGGCTGCTCCTGGGCAGGGG + Intergenic
1062107192 9:134762148-134762170 GCCAAGAGGCTGCGGGGCATTGG + Intronic
1062179633 9:135184336-135184358 GCCCGGAGGCTGCTGGGCAGTGG - Intergenic
1062194625 9:135266044-135266066 GCCAGGAGGCTGCTGGTGAGGGG + Intergenic
1062342780 9:136101090-136101112 TCTACGATCCTGCTGGGCAAAGG + Intergenic
1062731425 9:138112371-138112393 ACCAGGATGATGGTGGGGAAGGG - Intronic
1186505742 X:10090574-10090596 CCCAGGGTGCTCCTGAGCAAAGG + Intronic
1186561385 X:10617441-10617463 GCCAGGATGCTGCTGTTTCAAGG - Intronic
1187206061 X:17182522-17182544 TCAAGGCTGCTGCTGGCCAAGGG + Intergenic
1188518754 X:31014714-31014736 GCCAGGAACCTGTCGGGCAAGGG + Intergenic
1189851226 X:45178127-45178149 GCCAGGACCCAGCTGGGCATGGG - Intronic
1189882069 X:45503896-45503918 ACCAGGTGGCTGCTGGGCAGGGG + Intergenic
1195233111 X:102871131-102871153 GCCCGGATGGTGCTGGGGAAGGG + Intergenic
1197790464 X:130249021-130249043 GGCAGGGTGCTGGTGGGCACAGG - Intronic
1198487138 X:137098803-137098825 GCCAGGAGGCTGCAGTGCAGTGG + Intergenic
1200163106 X:154019265-154019287 GCAGGGATGCTGCTGGGCCTCGG + Exonic