ID: 1161948526

View in Genome Browser
Species Human (GRCh38)
Location 19:7454091-7454113
Sequence TGGGATTAGCAGCACCATCT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 181
Summary {0: 1, 1: 0, 2: 2, 3: 27, 4: 151}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161948519_1161948526 22 Left 1161948519 19:7454046-7454068 CCATCTTGGATCAGTGGGCATCA 0: 1
1: 1
2: 2
3: 11
4: 116
Right 1161948526 19:7454091-7454113 TGGGATTAGCAGCACCATCTTGG 0: 1
1: 0
2: 2
3: 27
4: 151

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161948526 Original CRISPR TGGGATTAGCAGCACCATCT TGG Intronic
901444396 1:9298972-9298994 CGAGATTAGCACCACCATCAAGG + Intronic
901477066 1:9497091-9497113 CGAGATTAGCACCACCATCAAGG - Intergenic
902717127 1:18280583-18280605 TAGCAATAGCACCACCATCTAGG - Intronic
905480875 1:38261198-38261220 TGGCATTAACAGCACCTGCTGGG + Intergenic
907022964 1:51086787-51086809 TGGGATGTGCAGCACCACATTGG + Intergenic
909337314 1:74490722-74490744 TGGGATGAGTAGCTCCCTCTTGG - Intronic
911477466 1:98391185-98391207 TTGGAATAGCAACACCATTTGGG - Intergenic
912272784 1:108227947-108227969 TGAGATAATGAGCACCATCTGGG - Intronic
912295436 1:108466375-108466397 TGAGATAATGAGCACCATCTGGG + Intronic
913599149 1:120406070-120406092 TGAGATAACGAGCACCATCTGGG + Intergenic
914088228 1:144473550-144473572 TGAGATAACGAGCACCATCTGGG - Intergenic
914310383 1:146460660-146460682 TGAGATAACGAGCACCATCTGGG + Intergenic
914379353 1:147102641-147102663 TGAGATAAAGAGCACCATCTGGG - Intergenic
914591726 1:149112482-149112504 TGAGATAACGAGCACCATCTGGG - Intergenic
920011932 1:202874224-202874246 GTGGATTGGCAGCACCATCCTGG + Intergenic
922618400 1:226976642-226976664 TGGCATTAGTGGCACCTTCTGGG + Intronic
1068465575 10:57385961-57385983 TTGGATTACCAGCACAATGTAGG + Intergenic
1068649000 10:59500811-59500833 TGGGATGAGCAGAAGCATGTAGG + Intergenic
1070127585 10:73634579-73634601 TCTGATCAGCAGCACCATCTGGG - Exonic
1070397109 10:76020718-76020740 TGGGGTCTTCAGCACCATCTTGG - Intronic
1071416162 10:85443989-85444011 AGGGACTAACATCACCATCTTGG - Intergenic
1074244183 10:111670861-111670883 AGAGATTAGCACCACCATCAAGG - Intergenic
1074292895 10:112154117-112154139 TGGGATTAGGACCACAATCTTGG - Intronic
1075060239 10:119252147-119252169 TGTGAGTAGCAGGACCATCCTGG + Intronic
1075775545 10:124983577-124983599 TGAGATTAGCACCAGCACCTCGG - Exonic
1076165451 10:128278718-128278740 CGGGATGAGCAGCAGCATCGTGG - Intergenic
1081415680 11:42812253-42812275 TGTGACTAGCCACACCATCTTGG - Intergenic
1082776551 11:57249330-57249352 TGGGCTTAGGTGCACCCTCTGGG - Intergenic
1083053308 11:59795965-59795987 GAAGATTAGCAGCACCACCTGGG - Intronic
1083350832 11:62027666-62027688 TGGCATTTGCAGCTCCAACTGGG - Intergenic
1085686837 11:78631203-78631225 TGGACCTAGAAGCACCATCTGGG + Intergenic
1095125050 12:38467025-38467047 TGGCATTAGCATCATCTTCTTGG - Intergenic
1097843149 12:64341340-64341362 TGGGAGGAACAGCACCATATTGG + Intronic
1099941745 12:89197227-89197249 TGGGAGGAGCAGCACTATCTGGG + Intergenic
1101054603 12:100899232-100899254 TGGGCTTAGAAACAACATCTTGG + Intronic
1101373978 12:104154965-104154987 TAGGATTGGCTGCACCCTCTAGG - Intergenic
1105623046 13:22087566-22087588 TGTGATTAGCACCTCCACCTTGG + Intergenic
1107890158 13:44907116-44907138 TGGGTTTAGCAGGAGCATCAGGG + Intergenic
1110744540 13:79037431-79037453 CAGGATTAGCAGCATCACCTGGG - Intergenic
1117546724 14:56798871-56798893 TGAGATTAGCAGCACCATGTGGG + Intergenic
1118189436 14:63567171-63567193 TGGGTGTAGTGGCACCATCTCGG - Intergenic
1118381964 14:65224837-65224859 TGGCAGTAGCAGCTCCTTCTTGG - Intergenic
1119615602 14:76096799-76096821 TGGCAGTGGCAGCACCAGCTGGG - Intergenic
1120532982 14:85656675-85656697 TGGAATTTGCAGCATCATTTTGG + Intergenic
1121884226 14:97527965-97527987 AGGGATTAGAAGCAGCATCAGGG + Intergenic
1123026306 14:105425885-105425907 TGGGCTTTGCACCACCCTCTAGG + Intronic
1124252396 15:28115440-28115462 TGGGATGAGCCTCACCATCGCGG - Exonic
1127581499 15:60342964-60342986 TGGGTTTTGGAGAACCATCTTGG - Intergenic
1127802613 15:62490607-62490629 TGGTATTAGCAGGAGCTTCTCGG + Intronic
1128833508 15:70790536-70790558 TGGGATAAGTGGCACAATCTGGG - Intergenic
1130235013 15:82125442-82125464 AGTGCTTAGCAGCACCATGTGGG - Intergenic
1130644151 15:85708962-85708984 TCGGACTATCAGCATCATCTGGG - Intronic
1134908566 16:18003556-18003578 AGGGATTATCATCCCCATCTGGG - Intergenic
1135504907 16:23027825-23027847 TGGGATTTGCAGCATCACCTGGG + Intergenic
1135628525 16:24017014-24017036 TGGCATTTCCAGCACAATCTGGG + Intronic
1139308002 16:66004445-66004467 GGGCATCACCAGCACCATCTTGG + Intergenic
1139808460 16:69590775-69590797 TGGGATTCCCCGCCCCATCTGGG + Intronic
1140976093 16:80061618-80061640 TGGGCTTAGAAAGACCATCTGGG - Intergenic
1141395889 16:83704365-83704387 TGGGAGTTGGAGAACCATCTCGG - Intronic
1143989049 17:10941212-10941234 TGGGAACAGCAGCAGCATCAGGG - Intergenic
1146449443 17:32960908-32960930 TGGTCTTAGCAGCACCTTTTGGG + Intergenic
1149460548 17:56826584-56826606 TGGAACTAGCAGCAGCACCTTGG + Intronic
1150914456 17:69422580-69422602 TGTGATCAGCAGCTCCACCTGGG - Intronic
1151714036 17:75822484-75822506 CGGGATGAACAGCAGCATCTGGG + Exonic
1152515124 17:80818744-80818766 TGGGATTTTCAGGACCATGTTGG + Intronic
1156053819 18:32972739-32972761 TGGGATTATTAGCACAAGCTGGG + Intronic
1160444838 18:78919255-78919277 GGAGTGTAGCAGCACCATCTCGG + Intergenic
1161948507 19:7453991-7454013 TTGGGTTGGTAGCACCATCTTGG + Intronic
1161948526 19:7454091-7454113 TGGGATTAGCAGCACCATCTTGG + Intronic
1161948549 19:7454190-7454212 TTGGATCAGTGGCACCATCTTGG + Intronic
1165130357 19:33628233-33628255 GGGCATGAGGAGCACCATCTGGG + Intronic
1165322341 19:35093866-35093888 AGTGATTAGCAGCACAATTTTGG - Intergenic
1165561322 19:36682656-36682678 GGGGAGCAGCGGCACCATCTTGG + Intergenic
1166188775 19:41161086-41161108 TGGGATTAGCAGCACCATGCTGG - Intergenic
929096049 2:38264043-38264065 TGGGATTGGCAGCTCCTTCCGGG + Intergenic
929441399 2:41968044-41968066 TGGGATCAGACGCACCAGCTAGG + Intergenic
931262611 2:60633192-60633214 AGTTATTAGCAGCAACATCTAGG - Intergenic
935183805 2:100713780-100713802 GGAGATTAGCGGCACCATCAAGG + Intergenic
940745152 2:157559621-157559643 TGGAATTAGCAGCTCCATGGGGG + Intronic
943810428 2:192180828-192180850 TGGCATTAGCAGTACCATGAAGG + Intronic
944570469 2:201039693-201039715 TGGTATTAGCGGCACCATGTGGG - Intronic
945756338 2:213851684-213851706 TGGGATTAGCACTACCAGCCAGG + Intronic
946683574 2:222243904-222243926 AGGAATTAGCAGCAACATCAAGG + Intronic
947531348 2:230910524-230910546 TGGGATCTGCTGCACCATCTGGG - Exonic
1170125548 20:12959617-12959639 TGGGGAAAGAAGCACCATCTTGG - Intergenic
1170126229 20:12967332-12967354 TGGGGAAAGAAGCACCATCTTGG - Intergenic
1170945398 20:20886939-20886961 CTGGATTGTCAGCACCATCTGGG + Intergenic
1172011860 20:31850404-31850426 TGGGAATAATAGCAGCATCTGGG + Intronic
1172824991 20:37774249-37774271 TGGGGATAGCTGCACCCTCTTGG - Intronic
1177842630 21:26251650-26251672 TGGGCTGTGCAGCACCATCCAGG - Intergenic
1179990676 21:44946883-44946905 TGGGATGTGAAGCACCAGCTTGG + Intronic
1181235165 22:21444203-21444225 TAGGAAGGGCAGCACCATCTGGG - Intronic
1184306012 22:43602383-43602405 TGGTCTCAGCAGCACCATCAGGG + Intronic
1185175889 22:49326333-49326355 TGGGATTTACAGCCCCATCCAGG - Intergenic
949131103 3:502199-502221 TGGGAGTAGTGGCACAATCTGGG - Intergenic
950367747 3:12500066-12500088 TGGGGAAAGCAGCACCATCCAGG - Intronic
950677847 3:14565357-14565379 TGGGAACAGCAGCCCCGTCTGGG - Intergenic
952117494 3:30200272-30200294 AGGGCTCAGAAGCACCATCTTGG + Intergenic
952943532 3:38460601-38460623 TGGGACTGGCAGCTCCAACTGGG + Intronic
954180939 3:48880883-48880905 TGGGATTAGCAATACCAGCACGG + Intronic
954647488 3:52140482-52140504 TGGGCTTCCCAGCACCATCAAGG + Intronic
956850369 3:73223255-73223277 CGGGGTTAACAGCACCATGTGGG + Intergenic
957659889 3:83135903-83135925 TGGGAACAGAAGAACCATCTAGG - Intergenic
958124174 3:89333819-89333841 TGGAATTAGCAGCGTGATCTTGG - Intronic
959797996 3:110456210-110456232 TATTATTATCAGCACCATCTAGG - Intergenic
961066756 3:123883062-123883084 TGGGCTTAGGAGGACCATTTGGG - Intronic
965574926 3:170208296-170208318 TGGGATTAGAGGCACGAGCTAGG - Intergenic
966044453 3:175531911-175531933 GGAGATTAGCACCACCATCAAGG - Intronic
967410393 3:189161073-189161095 TGGGATGATCAGGACAATCTAGG + Intronic
968226754 3:196977239-196977261 TGGGACTATCGGCACCATCGTGG - Intergenic
968563919 4:1299382-1299404 TGGGAAGAGCAGCAGCAGCTGGG - Intronic
968723180 4:2222802-2222824 TGGGAGCAGCTGCACCAGCTGGG - Intronic
971474409 4:27058619-27058641 TGGGGTTTGCAGCAGCTTCTGGG + Intergenic
976087286 4:81419341-81419363 TGGGACTAGAACCACAATCTAGG - Intergenic
976574888 4:86657756-86657778 TGGGTCTAGAAACACCATCTAGG + Intronic
977143760 4:93409340-93409362 TGGGATTAGCAGAAAGCTCTTGG + Intronic
979439908 4:120739335-120739357 AGAGATTACCAGCACCACCTTGG + Intronic
981880541 4:149605962-149605984 TGGGTTTAGAAACACCATCCAGG - Intergenic
982309258 4:153967265-153967287 TGCCATTTGCTGCACCATCTTGG - Intergenic
986687971 5:10290350-10290372 TGGGGTTAGGAGCACCAGGTGGG + Intronic
988856036 5:35229236-35229258 TGGGATTAGCAGCACTTCCCTGG + Intronic
992293551 5:75304899-75304921 TGAGAGCAGCACCACCATCTTGG + Intergenic
993307772 5:86292014-86292036 TGAGATAATGAGCACCATCTGGG + Intergenic
994183493 5:96793940-96793962 CGGGAATAGCAGCAAGATCTTGG + Exonic
997434079 5:133861596-133861618 TGGCTTTGGCAGCACCATGTGGG + Intergenic
997720556 5:136075341-136075363 TGGGACTGGCAGCATCACCTGGG + Intergenic
1004670991 6:17796712-17796734 TGGAAATGGCAGCTCCATCTGGG - Exonic
1004875242 6:19944718-19944740 TGGGATTTACAGCACCGTTTGGG - Intergenic
1005597942 6:27397347-27397369 TTGGTTTAGCAGCATCCTCTTGG - Intronic
1007160942 6:39791535-39791557 TGGGATTGGCAACACCCTCACGG - Intergenic
1007628962 6:43262260-43262282 TGGGACTAGCAAGGCCATCTTGG + Intronic
1014920594 6:127211025-127211047 CGGGAGTAGCAGCAGCTTCTGGG - Intergenic
1019794726 7:3041273-3041295 TGAGATTTTCAGCACCATCTCGG + Intronic
1022430970 7:30319871-30319893 TGGGAACAGCAGGATCATCTTGG - Intronic
1022891920 7:34709933-34709955 TGAGATTATCAGCACCTTCTGGG + Intronic
1034588900 7:152121757-152121779 TGGGTGGAGCAGAACCATCTTGG + Exonic
1036615822 8:10386677-10386699 TGGGATCAGCAGCATCACCTGGG - Intronic
1037927349 8:22854179-22854201 TGAGATTGGCAGCAGCCTCTAGG + Intronic
1043288623 8:78568037-78568059 TGGTATTAGCACCAAGATCTGGG + Intronic
1043771608 8:84208883-84208905 TGGGAGTAGCAGCTCTGTCTAGG + Intronic
1043965730 8:86473042-86473064 TGGGACTAGTAGAAGCATCTTGG - Exonic
1052758594 9:32566940-32566962 TGAGGTGAGCAGCACCAGCTCGG + Exonic
1053175907 9:35923696-35923718 TGGGAGTAGAAGCCCCATTTGGG + Intergenic
1055235992 9:74124033-74124055 TTGCATTAGAAGAACCATCTGGG + Intergenic
1060400968 9:123349520-123349542 TGGGATTAACAGCAGCTTCGTGG - Intergenic
1061326586 9:129868234-129868256 TGGGATCAGCAGCTCCGTCTCGG - Exonic
1061576132 9:131507743-131507765 TGGACTTTGCAGCAGCATCTGGG - Intronic
1185619879 X:1447327-1447349 TTGGATAAGCACCACCATCTTGG + Intronic
1185619886 X:1447381-1447403 TTGGAGAAGCACCACCATCTTGG + Intronic
1185619891 X:1447419-1447441 TTGGATAAGCACCACCATCTTGG + Intronic
1185619899 X:1447473-1447495 TTGGAGAAGCACCACCATCTTGG + Intronic
1185619906 X:1447511-1447533 TGGGAGAAGCACCACCATCTTGG + Intronic
1185619914 X:1447565-1447587 TTGGATAAGCACCACCATCTTGG + Intronic
1185619922 X:1447619-1447641 TTGGATAAGCACCACCATCTTGG + Intronic
1185619930 X:1447673-1447695 TTGGAGAAGCACCACCATCTTGG + Intronic
1185619945 X:1447784-1447806 TTGGATAAGCACCACCATCTTGG + Intronic
1185619949 X:1447822-1447844 TTGGATAAGCACTACCATCTTGG + Intronic
1185619968 X:1447950-1447972 TTGGAAAAGCACCACCATCTTGG + Intronic
1185619974 X:1447988-1448010 TTGGATAAGAACCACCATCTTGG + Intronic
1185619982 X:1448042-1448064 TTGGATAAGAACCACCATCTTGG + Intronic
1185619989 X:1448096-1448118 TTGGATAAGCACCACCATCTTGG + Intronic
1185619997 X:1448150-1448172 TTGGATAAGCACCACCATCTTGG + Intronic
1185620003 X:1448188-1448210 TTGGATAAGCACCACCATCTTGG + Intronic
1185620010 X:1448242-1448264 TTGGATAAGCACCACCATCTTGG + Intronic
1185620017 X:1448296-1448318 TTGGATAAGCACCACCATCTTGG + Intronic
1185620029 X:1448369-1448391 TTGGACAAGCACCACCATCTTGG + Intronic
1185620041 X:1448441-1448463 TTGGAAAAGCACCACCATCTTGG + Intronic
1185620047 X:1448495-1448517 TTGGATAAGCACCACCATCTTGG + Intronic
1185620055 X:1448552-1448574 TTGGATAAGCACCACCATCTTGG + Intronic
1185620063 X:1448606-1448628 TTGGATAAGCACCACCATCTTGG + Intronic
1185620069 X:1448644-1448666 TTGGATAAGCACCACCATCTTGG + Intronic
1185620076 X:1448698-1448720 TTGGAGAAGCACCACCATCTTGG + Intronic
1185620085 X:1448752-1448774 TTGGATAAGCACCACCATCTTGG + Intronic
1185620091 X:1448790-1448812 TTGGATAAGCACCACCATCTTGG + Intronic
1187009034 X:15261216-15261238 TGGCATTATCAGCACCAACAGGG - Intronic
1188853311 X:35158982-35159004 TGCGTGTAGTAGCACCATCTCGG - Intergenic
1188878799 X:35466715-35466737 CTGGAGTAGCAGCACGATCTCGG - Intergenic
1192803046 X:74485537-74485559 TGGGAGTGGCCGCCCCATCTTGG - Intronic
1195851311 X:109284716-109284738 TGTTATTAGCAGCACCAACCTGG + Intergenic
1198929159 X:141834993-141835015 TGGCATCAGCAGCACCGTGTTGG + Intergenic
1201711740 Y:17000233-17000255 TAGGATTAGCACCATCTTCTTGG + Intergenic