ID: 1161949407

View in Genome Browser
Species Human (GRCh38)
Location 19:7459529-7459551
Sequence CTTGATTCCCGGAGGCTTCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 107
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 94}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161949398_1161949407 28 Left 1161949398 19:7459478-7459500 CCAAAGTGTTGGGATTACAGGCG 0: 9450
1: 144047
2: 280281
3: 215306
4: 144319
Right 1161949407 19:7459529-7459551 CTTGATTCCCGGAGGCTTCCTGG 0: 1
1: 0
2: 0
3: 12
4: 94
1161949399_1161949407 1 Left 1161949399 19:7459505-7459527 CCACCATGCCTGTCCACTCCCTC 0: 1
1: 1
2: 13
3: 122
4: 1143
Right 1161949407 19:7459529-7459551 CTTGATTCCCGGAGGCTTCCTGG 0: 1
1: 0
2: 0
3: 12
4: 94
1161949400_1161949407 -2 Left 1161949400 19:7459508-7459530 CCATGCCTGTCCACTCCCTCTCT 0: 1
1: 1
2: 5
3: 94
4: 1038
Right 1161949407 19:7459529-7459551 CTTGATTCCCGGAGGCTTCCTGG 0: 1
1: 0
2: 0
3: 12
4: 94
1161949401_1161949407 -7 Left 1161949401 19:7459513-7459535 CCTGTCCACTCCCTCTCTTGATT 0: 1
1: 0
2: 1
3: 22
4: 316
Right 1161949407 19:7459529-7459551 CTTGATTCCCGGAGGCTTCCTGG 0: 1
1: 0
2: 0
3: 12
4: 94
1161949397_1161949407 29 Left 1161949397 19:7459477-7459499 CCCAAAGTGTTGGGATTACAGGC 0: 16492
1: 240790
2: 271963
3: 174140
4: 134914
Right 1161949407 19:7459529-7459551 CTTGATTCCCGGAGGCTTCCTGG 0: 1
1: 0
2: 0
3: 12
4: 94

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161949407 Original CRISPR CTTGATTCCCGGAGGCTTCC TGG Intronic
904757701 1:32777708-32777730 CTTGAGTCCAGGAGGTTTACAGG + Intronic
910505653 1:87947452-87947474 TGTGATTACCGGAGGCTACCAGG + Intergenic
913347379 1:117821636-117821658 CTTCATTCCTTGAGGCTTCCAGG - Intergenic
916056925 1:161074347-161074369 CCTGCTTCCCAGAGTCTTCCTGG + Exonic
917207262 1:172590233-172590255 CTTGATTCCCAGAGGGCTCATGG + Intronic
924735937 1:246755857-246755879 CTTGAAGCCCGGAGGCCTGCTGG - Intronic
1062823303 10:550794-550816 CTTGCTTCCCTGTTGCTTCCTGG - Intronic
1070740509 10:78900200-78900222 CTTCATTCCAGGAGGAATCCGGG - Intergenic
1071146060 10:82573796-82573818 TTTGATTACCCAAGGCTTCCTGG + Intronic
1073570360 10:104576191-104576213 CTTGGTTCCCACAGCCTTCCAGG + Intergenic
1074973794 10:118564951-118564973 CCTGACTCCTGGAAGCTTCCAGG - Intergenic
1081510713 11:43770083-43770105 CTTGATCCCCAGTGTCTTCCTGG + Intronic
1081656896 11:44863330-44863352 CTTCTTTCCCGCAGGCCTCCAGG + Intronic
1081851710 11:46278699-46278721 CCTGATTCCCTGGGGCTGCCAGG - Intronic
1084999891 11:73022793-73022815 CTTGATTCCTGCAGCCTTCAAGG - Intronic
1089983062 11:122788627-122788649 CTTCATTCCCTGAGCCTTCCTGG + Intronic
1091702782 12:2674759-2674781 CTTGAGTCCCCTAGGCTTGCTGG + Intronic
1092950510 12:13499102-13499124 CCTGCTTCCCTGAGGCTTCGGGG + Intergenic
1101883854 12:108644622-108644644 TTTTATTCCAGCAGGCTTCCAGG - Intergenic
1102198153 12:111039150-111039172 CTGAATTTCCGGTGGCTTCCTGG + Intronic
1102617037 12:114163770-114163792 CTGGCTTCTTGGAGGCTTCCAGG - Intergenic
1102899655 12:116626439-116626461 CTTGATTCCTGCAGGCACCCAGG + Intergenic
1103782567 12:123408880-123408902 CTTGATTCCTGGGGGCTGCCGGG - Exonic
1105217843 13:18299900-18299922 CTTGATTCCTGGGGGCTGCCGGG - Intergenic
1108159476 13:47623098-47623120 CTTCATTCCCGGGGGCTTGCTGG - Intergenic
1114220341 14:20690562-20690584 CTTGATTCCCTAAGACATCCAGG - Intronic
1117017078 14:51528842-51528864 GTTGATTCTAGGAAGCTTCCTGG - Intronic
1122710571 14:103654057-103654079 CTTGATGCCCTGTGTCTTCCAGG + Intronic
1129670290 15:77604218-77604240 ATTGAGTCACAGAGGCTTCCTGG + Intergenic
1129737516 15:77974480-77974502 AGTGATTCCAGGAGGATTCCAGG + Intergenic
1129848551 15:78779139-78779161 AGTGATTCCAGGAGGATTCCAGG - Intronic
1130233315 15:82113082-82113104 TTTGATTCCCACAGGCTTCCTGG - Intergenic
1130253371 15:82314807-82314829 AGTGATTCCAGGAGGATTCCAGG + Intergenic
1130819464 15:87479143-87479165 CTTGCTTTCAGGTGGCTTCCAGG + Intergenic
1132606219 16:794823-794845 TTTGGTTCCTGGAGGCCTCCTGG + Intronic
1137017627 16:35393242-35393264 CATTATTCCCTGAGGCTTTCAGG - Intergenic
1137785004 16:51131372-51131394 CTTGTTTCCAGGTGACTTCCAGG + Intergenic
1139343485 16:66287161-66287183 CTTGATTCCCTGATGGTTCCCGG - Intergenic
1139511283 16:67429987-67430009 CCTGCTTCCCGTGGGCTTCCAGG - Intergenic
1144604625 17:16653687-16653709 CTTGGCTCCCGGCGGCGTCCGGG - Intronic
1145208743 17:20997892-20997914 CATGGTACCCGGAGGCTTCGAGG + Intergenic
1147014364 17:37479092-37479114 CTTGATTAAGGAAGGCTTCCTGG + Exonic
1147843487 17:43388953-43388975 CTTAATTAAGGGAGGCTTCCTGG - Intergenic
1148163813 17:45468412-45468434 CTTGAGTTCCAGAGGCTGCCTGG + Exonic
1150395043 17:64815066-64815088 CTTGAGTTCCAGAGGCTGCCTGG + Intergenic
1152011415 17:77721045-77721067 AATGATTGCCCGAGGCTTCCTGG + Intergenic
1155747720 18:29381252-29381274 CTGGATTCCCAAAGGCATCCTGG + Intergenic
1160602500 18:80024587-80024609 CTTGCTTCCCTCAGCCTTCCGGG + Intronic
1161201069 19:3015140-3015162 CTTGATCCCCGGAGACTGGCAGG - Intronic
1161949407 19:7459529-7459551 CTTGATTCCCGGAGGCTTCCTGG + Intronic
1162742909 19:12783353-12783375 CTGGGTTCCCGGAGGTTTGCAGG - Intronic
1167321436 19:48799387-48799409 CTTCACTCCTGGAGGCTTCCAGG + Intronic
928593906 2:32842796-32842818 GTTGAGTCCAGTAGGCTTCCAGG - Intergenic
932180428 2:69642056-69642078 CTTGATTCCCCCAGGCTTTCGGG - Intronic
934296462 2:91746765-91746787 CTTGATTCCTGGGGGCTGCCGGG + Intergenic
939592698 2:144084964-144084986 GTAGATTCCTGGAGGCTACCAGG - Intronic
942726871 2:179019248-179019270 GTTGATTCCTGGAGTCTTCAGGG - Intronic
943682558 2:190783472-190783494 CTGGAATCCAGGAGGCTACCTGG + Intergenic
946725329 2:222656345-222656367 CTGAAGTCCCGGATGCTTCCAGG + Intergenic
1171100402 20:22377862-22377884 CTTAACTCCTAGAGGCTTCCTGG + Intergenic
1174653716 20:52152388-52152410 TTTGATTGCCAGAGCCTTCCTGG + Exonic
1175762545 20:61571394-61571416 CTTGATGCCCAGAGGGTACCTGG + Intronic
1175934295 20:62508013-62508035 TTTGGTTCCAGGAGGCGTCCAGG + Intergenic
1176374529 21:6080531-6080553 CTTGCTGCCAGGAGGCTCCCCGG + Intergenic
1177226597 21:18264865-18264887 CTTGATTTCTGGAAGCTTACTGG - Intronic
1179748946 21:43457714-43457736 CTTGCTGCCAGGAGGCTCCCCGG - Intergenic
1181884208 22:26006852-26006874 TTTGATGCCCGGAGGAATCCCGG + Intronic
949672646 3:6417435-6417457 CTTGATTCCTAAAAGCTTCCAGG - Intergenic
951667419 3:25142729-25142751 CTTGGTTTCTGGAGGCTTTCTGG - Intergenic
955074009 3:55595838-55595860 CTTTATTGCCTGAGGCTGCCTGG - Intronic
955694315 3:61620480-61620502 TTTGATTCCTGGCGGATTCCAGG - Intronic
961313049 3:126016071-126016093 CTTGCTTCCAGGAGGCTCCTGGG - Intronic
961664097 3:128485784-128485806 CTTCCACCCCGGAGGCTTCCTGG - Exonic
965669819 3:171135820-171135842 CTTAATTCCCTCATGCTTCCTGG - Intronic
967197179 3:187038599-187038621 CCTGAGCCCTGGAGGCTTCCTGG + Intronic
971918628 4:32908925-32908947 CTTGAAGCCAGGGGGCTTCCAGG + Intergenic
973641212 4:52904747-52904769 CTTGGCTCCAGGAGGCTGCCAGG - Intronic
975195326 4:71518002-71518024 CTTGGTTCAAGGAGTCTTCCTGG + Intronic
987019933 5:13859864-13859886 CTTGATTCCACCAAGCTTCCAGG + Intronic
991113783 5:62930431-62930453 CCTGTTTCCCGGAGGATTTCTGG - Intergenic
995051088 5:107704856-107704878 CTTGAGTCCTGGAGGCCTTCTGG - Intergenic
998394182 5:141807653-141807675 CTTGATCCCCTGTGGCTTCTGGG - Intergenic
999734440 5:154502186-154502208 CTTGATTCCTGGAGCATCCCTGG + Intergenic
1000016058 5:157277672-157277694 ATTGATTGCTGGTGGCTTCCTGG + Intronic
1001448349 5:171805273-171805295 CTTGGTGCCGGGAGGCGTCCGGG - Intergenic
1001452279 5:171836070-171836092 GGTGACTCCCAGAGGCTTCCAGG + Intergenic
1001818181 5:174688912-174688934 CTGGATTCCAGGAGGATTTCGGG - Intergenic
1004656969 6:17672163-17672185 CTTGATTGCCATAGGCTTCCCGG - Intronic
1006643290 6:35499212-35499234 CTTGTTTCCCTGAGTCTTCCAGG + Intronic
1007246255 6:40465386-40465408 CATGTTTCCTGGAGACTTCCAGG - Intronic
1010262120 6:73829463-73829485 AGTGATTCCTGGGGGCTTCCAGG + Intergenic
1017446407 6:154510554-154510576 CTGGCGTCCCGGAGCCTTCCCGG + Exonic
1018130247 6:160723461-160723483 CTTTGTTCCTGGAGACTTCCTGG + Intronic
1029270753 7:99375262-99375284 CTCCATCCCCGGAGCCTTCCGGG + Intronic
1034818094 7:154191755-154191777 CCTGATTCCCTGATGCTTTCAGG - Intronic
1034993063 7:155560144-155560166 CCTGAGTCCCGGCTGCTTCCTGG - Intergenic
1036179060 8:6567633-6567655 ATTGGCTCCCCGAGGCTTCCTGG - Intronic
1040330948 8:46385524-46385546 CTTGATTCCCAGAAGCCCCCAGG + Intergenic
1043500870 8:80853860-80853882 CTTGTTTCCCAGTGACTTCCAGG - Intronic
1046009138 8:108525138-108525160 CTTGATTCCAAGAGGATTCTTGG + Intergenic
1047766044 8:127990875-127990897 CTCCATGCCGGGAGGCTTCCTGG + Intergenic
1049534476 8:143171932-143171954 CCTGATCCCCGAGGGCTTCCAGG + Intergenic
1050800047 9:9599402-9599424 CTTGAGTGCTTGAGGCTTCCTGG - Intronic
1062381702 9:136290029-136290051 CCAGGCTCCCGGAGGCTTCCAGG + Exonic
1189933071 X:46035577-46035599 CTTGTTTCTTGGAGTCTTCCTGG + Intergenic
1193440751 X:81537205-81537227 CTTCATTTCCGGATGCTTTCAGG + Intergenic
1196760673 X:119198123-119198145 CTTTATTCCAGGAGGCTGACTGG - Intergenic