ID: 1161949921

View in Genome Browser
Species Human (GRCh38)
Location 19:7462280-7462302
Sequence GACCCATCCGAGACCCTGCA GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 123
Summary {0: 1, 1: 1, 2: 0, 3: 15, 4: 106}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161949907_1161949921 11 Left 1161949907 19:7462246-7462268 CCTGCCCCAGCCCCGAGGCCTAT 0: 1
1: 0
2: 0
3: 35
4: 430
Right 1161949921 19:7462280-7462302 GACCCATCCGAGACCCTGCAGGG 0: 1
1: 1
2: 0
3: 15
4: 106
1161949909_1161949921 6 Left 1161949909 19:7462251-7462273 CCCAGCCCCGAGGCCTATTCCGT 0: 1
1: 0
2: 0
3: 5
4: 43
Right 1161949921 19:7462280-7462302 GACCCATCCGAGACCCTGCAGGG 0: 1
1: 1
2: 0
3: 15
4: 106
1161949916_1161949921 -1 Left 1161949916 19:7462258-7462280 CCGAGGCCTATTCCGTGGAGGGG 0: 1
1: 0
2: 0
3: 8
4: 75
Right 1161949921 19:7462280-7462302 GACCCATCCGAGACCCTGCAGGG 0: 1
1: 1
2: 0
3: 15
4: 106
1161949914_1161949921 0 Left 1161949914 19:7462257-7462279 CCCGAGGCCTATTCCGTGGAGGG 0: 1
1: 0
2: 0
3: 4
4: 57
Right 1161949921 19:7462280-7462302 GACCCATCCGAGACCCTGCAGGG 0: 1
1: 1
2: 0
3: 15
4: 106
1161949908_1161949921 7 Left 1161949908 19:7462250-7462272 CCCCAGCCCCGAGGCCTATTCCG 0: 1
1: 0
2: 0
3: 4
4: 108
Right 1161949921 19:7462280-7462302 GACCCATCCGAGACCCTGCAGGG 0: 1
1: 1
2: 0
3: 15
4: 106
1161949905_1161949921 20 Left 1161949905 19:7462237-7462259 CCTCGAAGACCTGCCCCAGCCCC 0: 1
1: 1
2: 1
3: 57
4: 455
Right 1161949921 19:7462280-7462302 GACCCATCCGAGACCCTGCAGGG 0: 1
1: 1
2: 0
3: 15
4: 106
1161949910_1161949921 5 Left 1161949910 19:7462252-7462274 CCAGCCCCGAGGCCTATTCCGTG 0: 1
1: 0
2: 0
3: 4
4: 48
Right 1161949921 19:7462280-7462302 GACCCATCCGAGACCCTGCAGGG 0: 1
1: 1
2: 0
3: 15
4: 106
1161949912_1161949921 1 Left 1161949912 19:7462256-7462278 CCCCGAGGCCTATTCCGTGGAGG 0: 1
1: 0
2: 0
3: 3
4: 34
Right 1161949921 19:7462280-7462302 GACCCATCCGAGACCCTGCAGGG 0: 1
1: 1
2: 0
3: 15
4: 106
1161949918_1161949921 -7 Left 1161949918 19:7462264-7462286 CCTATTCCGTGGAGGGGACCCAT 0: 1
1: 0
2: 0
3: 0
4: 36
Right 1161949921 19:7462280-7462302 GACCCATCCGAGACCCTGCAGGG 0: 1
1: 1
2: 0
3: 15
4: 106

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161949921 Original CRISPR GACCCATCCGAGACCCTGCA GGG Exonic
900623460 1:3597732-3597754 GCCCCCTCAGAGCCCCTGCAGGG + Intronic
900641298 1:3689238-3689260 GCCCCAGCCGACCCCCTGCAGGG + Intronic
901511394 1:9719779-9719801 GACCCCTGGGAGACCCTGCTTGG - Intronic
901769337 1:11522573-11522595 GACCCAGCCAAGACCCAGCCAGG + Intronic
905367109 1:37458586-37458608 GGCCCTTCCCAGACCCTGCAGGG + Intergenic
905943404 1:41882392-41882414 GGCCAATCCCAGCCCCTGCATGG + Intronic
907733519 1:57089972-57089994 GACACAGCCGACACCCAGCATGG + Intronic
918595286 1:186286243-186286265 GTTCAATCCGACACCCTGCAAGG - Intergenic
918718115 1:187817987-187818009 GCCCCAGCAGAGACTCTGCATGG + Intergenic
919801148 1:201355280-201355302 GAGCCAGCCCAGACCCAGCATGG + Intergenic
920193285 1:204209321-204209343 ACCCCATCCCTGACCCTGCAGGG + Intronic
1064155065 10:12897081-12897103 GACCCCCCCCAGACACTGCAGGG - Exonic
1064272439 10:13877803-13877825 GAACCATCCCAGACACTTCATGG + Intronic
1065210317 10:23396371-23396393 CACGCATCCGAGACCCTGGAGGG + Intergenic
1065987012 10:30964660-30964682 GACCTATCCGTGACACTGCTTGG - Intronic
1069695260 10:70381606-70381628 TGCCCATCCGAGCCCCTGCCAGG - Exonic
1070597234 10:77841162-77841184 GGCCCATCCAAGCCCCCGCAGGG + Intronic
1070947994 10:80408834-80408856 GACCCTTCCGCCACCCTGCGTGG + Intronic
1076585338 10:131543323-131543345 TACTCATCAGAGACCGTGCATGG + Intergenic
1076778267 10:132709958-132709980 CACCCATCGGGGACCCTGTAAGG - Intronic
1077581135 11:3418032-3418054 GACCCATGGGAGACAGTGCAGGG - Intergenic
1084238064 11:67800870-67800892 GACCCATGGGAGACAATGCAGGG - Intergenic
1084694357 11:70744818-70744840 GACCAAGCTGAGACCTTGCAGGG - Intronic
1084834347 11:71791964-71791986 GACCCATGGGAGACAGTGCAGGG + Intronic
1091450584 12:570031-570053 GACCCCTCCGAGGCCCAGGACGG + Intronic
1091719445 12:2801870-2801892 GGACCATCCAAGACCCTGAAGGG - Intronic
1091793337 12:3283815-3283837 GCCCCATCCGAGAGCCTCCTGGG - Exonic
1092408734 12:8238500-8238522 GACCCATGGGAGACAGTGCAGGG - Intergenic
1102579514 12:113877359-113877381 TACCCCTCCCAGACCCTACAGGG + Intronic
1104496974 12:129250041-129250063 CACCCAGACGAGACTCTGCAAGG + Intronic
1104596868 12:130126057-130126079 GACCCATCCTAGCGCCTGCCTGG + Intergenic
1105303580 13:19154727-19154749 GACCCATCCTATTCCCTGCAGGG - Intergenic
1107208058 13:37819513-37819535 GCCCCATCCATGTCCCTGCAAGG - Intronic
1118485638 14:66212305-66212327 GACCCAGCCAAGAACCTGGAAGG + Intergenic
1118766012 14:68909757-68909779 GCCCCATCTAAGACACTGCAGGG + Intronic
1122207608 14:100155911-100155933 GCCCCATCAGAGACCCAGCCAGG - Intronic
1124123028 15:26908505-26908527 GCCCCATCGGAAAGCCTGCAGGG - Intronic
1124883479 15:33662653-33662675 CCCACATCCGAGACCCTGTAGGG + Exonic
1126170742 15:45693312-45693334 AAGCCTTCCTAGACCCTGCAGGG - Intergenic
1133329972 16:4966867-4966889 TACCCCTTCGGGACCCTGCAAGG + Intronic
1133349699 16:5093317-5093339 GACCCATGGGAGACAGTGCAGGG - Intronic
1144498012 17:15762368-15762390 GCCCCAGCGGAGACCCTGTATGG - Intergenic
1145161389 17:20577421-20577443 GCCCCAGCGGAGACCCTGTATGG - Intergenic
1146809180 17:35889910-35889932 GGCCCATCAGTGAGCCTGCAGGG - Intergenic
1148795336 17:50194280-50194302 GCCTCATCCCAGACCCTACACGG + Intronic
1150641477 17:66952784-66952806 GCCCCATCCCAGGCCCTGCCCGG + Intergenic
1151313702 17:73309785-73309807 GGCCCCTCCTAGTCCCTGCAGGG + Intronic
1152031393 17:77845620-77845642 GAGCCCCCCGACACCCTGCAGGG - Intergenic
1152101060 17:78301963-78301985 GACCCATCCCAGACACTGCCTGG - Intergenic
1156003091 18:32407710-32407732 CAACCATCTGAGACCCTGAAGGG + Intronic
1160544180 18:79641920-79641942 GACCCAGCCGAGACCCTGCAGGG + Intergenic
1160726180 19:618785-618807 GTCCCACCCGAGGCCCAGCACGG + Intronic
1161575264 19:5051391-5051413 AACCCATCAGACACCCTGCAGGG + Intronic
1161949921 19:7462280-7462302 GACCCATCCGAGACCCTGCAGGG + Exonic
1163073761 19:14869544-14869566 GAACCATCCAAGACCCTACATGG - Intergenic
1164091797 19:21960571-21960593 CACACATCAGAGTCCCTGCAAGG - Intronic
925466699 2:4112411-4112433 GTCACCTACGAGACCCTGCAAGG + Intergenic
929563552 2:42970408-42970430 TACCCATCTAAGAGCCTGCAGGG + Intergenic
935683158 2:105655938-105655960 GACCCAGCAGTGACACTGCATGG + Intergenic
944423612 2:199557009-199557031 GACACAGCAGAGACCCTGCAGGG - Intergenic
946399429 2:219460817-219460839 GACCCAGCTGAGGCCCTGCACGG - Intronic
947801101 2:232928748-232928770 AACCCATCCCAGACCCGCCAGGG - Intronic
1176688444 21:9875743-9875765 GCCCCAGTGGAGACCCTGCATGG + Intergenic
1179190502 21:39118556-39118578 ACCCCATCCGAGACCCTGCTGGG - Intergenic
1179590305 21:42403687-42403709 GGTCCAACCGAGCCCCTGCACGG - Intergenic
1180223173 21:46372837-46372859 GACCCACACGATACCCAGCAGGG - Intronic
1180936976 22:19632318-19632340 CCCCCATCCCACACCCTGCAAGG - Intergenic
1181601874 22:23957706-23957728 CCCCCATCCCAGACCCTTCAGGG + Exonic
1181606635 22:23983601-23983623 CCCCCATCCCAGACCCTTCAGGG - Exonic
1183945330 22:41322636-41322658 GCCCCTTCCGAGGCCCTGGAAGG + Intronic
954510930 3:51124271-51124293 GACCCCTCACAGACCCTGCAGGG + Intronic
954909051 3:54087872-54087894 GAGCCATCTGGGACCCTGCGGGG + Intergenic
954943245 3:54393986-54394008 GAAGCATCCTAGACCCTGTATGG - Intronic
957054002 3:75430665-75430687 GACCCATGGGAGACAGTGCAGGG - Intergenic
959737726 3:109679597-109679619 GACCCATCAGTGAGCCTCCAAGG + Intergenic
961300835 3:125921050-125921072 GACCCATGGGAGACAGTGCAGGG + Intergenic
961887672 3:130107042-130107064 GACCCATGGGAGACAGTGCAGGG - Intronic
965669118 3:171128442-171128464 GACCCATAGGAGTTCCTGCAAGG - Intronic
968554084 4:1238602-1238624 GTCCCCTCCGAGACCCTCCAAGG + Intronic
968594852 4:1477066-1477088 GGCCCATCCGTGCCCCTCCAGGG + Intergenic
968636847 4:1685069-1685091 GACACACCCGAGCCCCAGCACGG - Intergenic
968659561 4:1793480-1793502 GACCCCTCCGCGAGCCTGCCCGG - Intronic
968892433 4:3376708-3376730 GACCCAGCCATGACCCTCCAAGG - Intronic
968996806 4:3950972-3950994 GACCCATGGGAGACAGTGCAGGG - Intergenic
969757202 4:9157704-9157726 GACCCATGGGAGACAGTGCAGGG + Intergenic
970490161 4:16564011-16564033 GACCCAGCTGTAACCCTGCAAGG - Intronic
977552404 4:98456392-98456414 TACCCATCAGGGGCCCTGCAAGG - Intergenic
980351819 4:131693538-131693560 GCCCCAGTGGAGACCCTGCATGG + Intergenic
994209062 5:97068067-97068089 GACCCATTCTAGACCCTACATGG + Intergenic
997187986 5:131901130-131901152 GACCTACCCCACACCCTGCAAGG + Intronic
1003122478 6:3329535-3329557 GCCTCATCCCATACCCTGCATGG - Intronic
1003131278 6:3397143-3397165 CTCCCATCCCACACCCTGCAAGG + Intronic
1003176738 6:3757627-3757649 GACACATCCCAGACCAAGCAAGG - Intergenic
1003426812 6:6003296-6003318 GACTCATCCGTGACCCCGCCCGG - Intronic
1005670859 6:28104952-28104974 GCGCCGTCCGAGACACTGCACGG + Intergenic
1005984103 6:30859837-30859859 GCCCCAGTGGAGACCCTGCATGG + Intergenic
1007661390 6:43488983-43489005 GAGTCATCAGAGAGCCTGCAGGG + Intronic
1009193472 6:60656823-60656845 GACCCATACAGGACACTGCAGGG - Intergenic
1019382511 7:731791-731813 GTCCTATTAGAGACCCTGCACGG + Intronic
1022565034 7:31391117-31391139 GACCCTGCAGAGACCCTGCAGGG + Intergenic
1026955252 7:74372690-74372712 GACCCAGCCGGGACACAGCAAGG + Intronic
1029885221 7:103862591-103862613 GAACCATCAGAGAACCTGAAAGG - Intronic
1035049170 7:155988571-155988593 GACCAACCAGAGACCCAGCACGG - Intergenic
1035734881 8:1880972-1880994 GTCCCATCAGACACCCTGCAGGG - Intronic
1035864696 8:3069764-3069786 GCCCCATTGGAGACTCTGCATGG + Intronic
1036380435 8:8233019-8233041 GACCCATGGGAGACAGTGCAGGG + Intergenic
1036849130 8:12189641-12189663 GACCCATGGGAGACAGTGCAGGG - Intronic
1036870491 8:12431915-12431937 GACCCATGGGAGACAGTGCAGGG - Intronic
1037724675 8:21473371-21473393 GAGCCCCCAGAGACCCTGCAGGG + Intergenic
1040317171 8:46270209-46270231 GACCCATACAAGACACTGCAGGG + Intergenic
1041244052 8:55874285-55874307 GAACCATCGGGGACCCTTCAGGG - Intergenic
1048026288 8:130590135-130590157 GACCCATCCGAGTCTCAGAAGGG - Intergenic
1048284941 8:133134284-133134306 GACCCTTCCTAGAGCCTCCAGGG - Intronic
1049393618 8:142385218-142385240 GACACCTCCAAGACCCTGAAAGG + Intronic
1049427137 8:142542572-142542594 CGCCCATCCGGGACCCAGCACGG + Exonic
1053059155 9:35015826-35015848 GACTCATCCGAGGCCAGGCATGG + Intergenic
1053469592 9:38336652-38336674 GATCCATCCCAGACACAGCATGG + Intergenic
1053780896 9:41606159-41606181 GCCCCAGTGGAGACCCTGCATGG - Intergenic
1054168839 9:61816316-61816338 GCCCCAGTGGAGACCCTGCATGG - Intergenic
1054668692 9:67764495-67764517 GCCCCAGTGGAGACCCTGCATGG + Intergenic
1059736946 9:117110314-117110336 GACCCATCCTAGACACAGGATGG + Intronic
1061154831 9:128852038-128852060 GACCCATACAGGACACTGCAGGG - Intronic
1189029574 X:37436868-37436890 GACGCATCCCAGACCCTCCTTGG + Intronic