ID: 1161951631

View in Genome Browser
Species Human (GRCh38)
Location 19:7470923-7470945
Sequence GCCACTGATGTTCCCTCAGT GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 174
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 164}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161951631_1161951639 3 Left 1161951631 19:7470923-7470945 CCCACTGAGGGAACATCAGTGGC 0: 1
1: 0
2: 0
3: 9
4: 164
Right 1161951639 19:7470949-7470971 CCAGTCAGGTTCTGTGGGTTTGG 0: 1
1: 0
2: 0
3: 14
4: 186
1161951631_1161951641 21 Left 1161951631 19:7470923-7470945 CCCACTGAGGGAACATCAGTGGC 0: 1
1: 0
2: 0
3: 9
4: 164
Right 1161951641 19:7470967-7470989 TTTGGAAGCCCATCGTGAAAGGG 0: 1
1: 0
2: 0
3: 7
4: 120
1161951631_1161951640 20 Left 1161951631 19:7470923-7470945 CCCACTGAGGGAACATCAGTGGC 0: 1
1: 0
2: 0
3: 9
4: 164
Right 1161951640 19:7470966-7470988 GTTTGGAAGCCCATCGTGAAAGG 0: 1
1: 0
2: 0
3: 2
4: 92
1161951631_1161951642 22 Left 1161951631 19:7470923-7470945 CCCACTGAGGGAACATCAGTGGC 0: 1
1: 0
2: 0
3: 9
4: 164
Right 1161951642 19:7470968-7470990 TTGGAAGCCCATCGTGAAAGGGG 0: 1
1: 0
2: 0
3: 20
4: 624
1161951631_1161951634 -3 Left 1161951631 19:7470923-7470945 CCCACTGAGGGAACATCAGTGGC 0: 1
1: 0
2: 0
3: 9
4: 164
Right 1161951634 19:7470943-7470965 GGCCCTCCAGTCAGGTTCTGTGG 0: 1
1: 0
2: 0
3: 15
4: 179
1161951631_1161951635 -2 Left 1161951631 19:7470923-7470945 CCCACTGAGGGAACATCAGTGGC 0: 1
1: 0
2: 0
3: 9
4: 164
Right 1161951635 19:7470944-7470966 GCCCTCCAGTCAGGTTCTGTGGG 0: 1
1: 0
2: 0
3: 11
4: 92

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161951631 Original CRISPR GCCACTGATGTTCCCTCAGT GGG (reversed) Exonic
900846953 1:5111694-5111716 GCCAGTGATGTTCCCTGGGTGGG + Intergenic
901492080 1:9601763-9601785 GCCTCTGGGGTTCCCTGAGTGGG + Intronic
904964254 1:34359473-34359495 GCCACTCATGTCCCCTCTCTGGG + Intergenic
904969804 1:34410596-34410618 GCCACCCATGCTCCCTCAGTTGG + Intergenic
906774367 1:48515473-48515495 GTCACACATGTTCCCTCATTTGG - Intergenic
907719519 1:56958641-56958663 GCCGCAGACGTTCCCTCAGCTGG - Intronic
912798260 1:112705837-112705859 GCCACTGCTGTCCCCCCAGCAGG + Exonic
913344179 1:117791591-117791613 GCCACTGATGTAGTCCCAGTAGG - Intergenic
914768079 1:150657492-150657514 GTCACACATGTTCCCTCATTTGG + Intronic
915180142 1:154051697-154051719 GTCACACATGTTCCCTCATTTGG + Intronic
917799353 1:178556207-178556229 GTCACACATGTTCCCTCATTTGG - Intergenic
920357086 1:205381853-205381875 GCCACTGATGTTTTCACAGGTGG - Exonic
921226730 1:213027667-213027689 GTCACACATGTTCCCTCATTTGG - Intergenic
923383125 1:233441361-233441383 GCCCCTGCTGTTCTCTCTGTGGG + Intergenic
924141454 1:241028122-241028144 GCCAGTGATGTTCACTAAGCAGG + Intronic
1065081931 10:22137753-22137775 GCCAGTGCTGTCCCCTCAGGCGG + Intergenic
1065720736 10:28626565-28626587 TTCACTGCTTTTCCCTCAGTGGG + Intergenic
1066129397 10:32377527-32377549 GTCCCTGATGTTCCCTCGGCTGG + Intronic
1067917345 10:50414869-50414891 GCCACTGATCATCCCTCTTTGGG + Intronic
1069056647 10:63851292-63851314 GTCACACATGTTCCCTCATTTGG + Intergenic
1069416906 10:68208711-68208733 GGCAGTGCTGTTTCCTCAGTTGG + Intronic
1075738764 10:124680518-124680540 CCCAGTGTTGTTCTCTCAGTTGG - Intronic
1076804050 10:132846398-132846420 GCCACGCTTGTTCCCTCTGTGGG + Intronic
1079976444 11:27097675-27097697 GACTGTCATGTTCCCTCAGTTGG - Intronic
1080553181 11:33391790-33391812 GACACTGACCTTCCATCAGTAGG - Intergenic
1081930612 11:46868344-46868366 GCCACTGATTATCCCACAGCAGG + Intronic
1083113072 11:60431080-60431102 GTCACTGATATTCCATCATTAGG + Intronic
1083164993 11:60878661-60878683 GCCACTTCTGTTCCAGCAGTAGG + Intergenic
1084059486 11:66661004-66661026 GCCAGTGATGCTACCTCATTGGG + Intronic
1085642470 11:78200971-78200993 GCCACTCACGTTCCCCAAGTAGG + Intronic
1088361974 11:109001031-109001053 ACCACTGATGTTCCCTTACATGG + Intergenic
1090459770 11:126880339-126880361 TTGACTGATGTTCTCTCAGTGGG - Intronic
1090840923 11:130487026-130487048 GCCACCAATGTCCCCTCGGTGGG + Intergenic
1091354294 11:134923793-134923815 CCCGGGGATGTTCCCTCAGTAGG + Intergenic
1092536240 12:9390004-9390026 GACAAAGATGTTCCTTCAGTTGG - Intergenic
1096218328 12:49810472-49810494 GCCACAGTGGTTCCCACAGTGGG + Intronic
1096450464 12:51736372-51736394 GCCACACATGTTCCCTCGTTTGG - Intronic
1101223374 12:102663375-102663397 GTCACACATGTTCCCTCATTTGG - Intergenic
1101501153 12:105304994-105305016 GTCACACATGTTCCCTCATTTGG - Intronic
1102937465 12:116909925-116909947 GCACCTGATATTCCCTCAGCAGG - Intergenic
1103963630 12:124624588-124624610 GCCAGTGATGTTCCAGCAGGTGG - Intergenic
1105955852 13:25282132-25282154 GCCCCTGTTGTTCCCTTTGTTGG + Intronic
1106660400 13:31793880-31793902 CCCACTGCTGTTGCCTTAGTTGG + Intronic
1106681705 13:32014970-32014992 GCCTCTGATATAACCTCAGTTGG + Intergenic
1107165502 13:37278012-37278034 GCCATTCATGTTCCCCCATTGGG - Intergenic
1109739458 13:66533042-66533064 GCCACTTATGTGCCCACACTGGG + Intronic
1109772995 13:67001471-67001493 GCCACTGCTTTTCCCTTATTGGG - Intronic
1112156151 13:96819239-96819261 GCCACTGATGTTCATCCAGAAGG - Intronic
1113786019 13:113002434-113002456 GCCACTGCTGTCCCCACAATGGG + Intronic
1114446351 14:22791678-22791700 ACCACTGCTGTTTCCTCAGAAGG + Intronic
1115504529 14:34080481-34080503 GCCACTGTTGTATCCACAGTAGG + Intronic
1115576083 14:34713969-34713991 GCCACTGACGTTTCCTCATAAGG + Intronic
1117326648 14:54675037-54675059 GCCACTGTGGTTGGCTCAGTAGG + Intronic
1121514518 14:94540570-94540592 GGCAGGGATGTTCCTTCAGTGGG - Intergenic
1202862284 14_GL000225v1_random:90278-90300 CCCACTGGTGCTCCCTCAGCTGG + Intergenic
1123788699 15:23697844-23697866 GTCACACATGTTCCCTCATTTGG - Intergenic
1128265876 15:66266274-66266296 GCCACGGGGGTTCCCTCAGCTGG + Intergenic
1129345000 15:74911849-74911871 GCCTCTGATGTTCCCTGTCTGGG - Intergenic
1129665691 15:77578267-77578289 GACACAGATGTTTCCTGAGTTGG - Intergenic
1133283720 16:4681030-4681052 GCCACTGTTCTTCCCTCACTGGG - Intronic
1134029532 16:10980569-10980591 TCCACTGACGTTCCCGCTGTGGG - Intronic
1135634642 16:24063592-24063614 GCCACTGATGTACTTTCACTGGG + Intronic
1139297606 16:65916888-65916910 GCCTCTGATGGTCTCTGAGTTGG - Intergenic
1139658079 16:68401222-68401244 GCCACTGTGTTTCCCTCAGGTGG - Intronic
1140877046 16:79162471-79162493 GCCACTGGTGTTCCTCTAGTAGG + Intronic
1146294254 17:31636839-31636861 GTCACACATGTTCCCTCATTTGG + Intergenic
1148347154 17:46910949-46910971 GCCACTGATGGTTCCTGAGCAGG + Intergenic
1149606902 17:57931534-57931556 GGCACTGCTGTTCCTGCAGTGGG + Intronic
1151434342 17:74085542-74085564 GGCACTGCTGTACCCTGAGTTGG + Intergenic
1153290074 18:3492474-3492496 GCCACTGATGGTCCTTGAATAGG + Intergenic
1153635114 18:7106768-7106790 GACACAGAAGTTCCCTCTGTGGG - Intronic
1154014866 18:10607441-10607463 GCCACTGCTTTTGCCTCAGGTGG - Intergenic
1154190626 18:12228137-12228159 GCCACTGCTTTTGCCTCAGGTGG + Intergenic
1157126237 18:44959080-44959102 GCCATTTATCTTCCCACAGTTGG + Intronic
1157126298 18:44959681-44959703 GCCACTGCTGTGTTCTCAGTGGG + Intronic
1161951631 19:7470923-7470945 GCCACTGATGTTCCCTCAGTGGG - Exonic
1162413281 19:10518877-10518899 GCCCCCGCTGTTCCCTCGGTGGG + Intergenic
1162467204 19:10849370-10849392 GCCTATGCTGTTCCCTCTGTTGG + Intronic
1164031840 19:21414222-21414244 GTCACACATGTTCCCTCATTTGG - Intronic
1165983894 19:39750767-39750789 GCCACTGATGTACCTTCTGGGGG + Intergenic
1168331635 19:55573389-55573411 GCCACTGATGGTTCCTGAGGAGG + Intergenic
925257614 2:2503561-2503583 GCCAGTGGTTTTCCCACAGTGGG - Intergenic
926034119 2:9621306-9621328 GCCAGTGATGTCTCCTAAGTGGG + Intronic
926476510 2:13329221-13329243 GCCACTGCTGTGCTCTCAGAAGG + Intergenic
928114302 2:28535965-28535987 GCCACTGGAGATCCCTCTGTGGG + Intronic
928298610 2:30106645-30106667 GACAGGGATGTTCCTTCAGTTGG + Intergenic
928399592 2:30968311-30968333 GCCACTGATCTTCACTAACTGGG + Intronic
931460876 2:62449002-62449024 GCCACAGATAATCCCTCAGCAGG + Intergenic
931904310 2:66825754-66825776 GTCACTGATGCTCCCTCCTTAGG - Intergenic
932581729 2:72996428-72996450 GCGGCTGATGGTCCCTCAGGTGG + Intronic
934512836 2:94961017-94961039 GACACTGGTGTTCCCTCACTTGG + Intergenic
935236054 2:101139148-101139170 GCTCCTGAGGTTCCCTCACTTGG + Intronic
938810346 2:134846957-134846979 GCAACTGCTGTTCCCCCACTTGG - Intronic
940310692 2:152275733-152275755 GTCACACATGTTCCCTCATTTGG - Intergenic
948314662 2:237018167-237018189 GCCACGGATGTTCCCACTGTTGG - Intergenic
1170383971 20:15795800-15795822 CCAACGGATGTTCCCACAGTCGG - Intronic
1171099309 20:22367744-22367766 GAGAATGATGTTCCCTCCGTGGG - Intergenic
1172106921 20:32522545-32522567 GCCATTCCTGTGCCCTCAGTAGG + Intronic
1173133724 20:40420200-40420222 TCCACTGGTGTTCCCTTTGTAGG - Intergenic
1181603793 22:23967609-23967631 GCCACTGATCCTGCCTCAGGGGG + Intronic
1181604720 22:23973698-23973720 GCCACTGATCCTGCCTCAGGGGG - Intronic
1181776029 22:25160763-25160785 GCCACTGACTCCCCCTCAGTGGG - Intronic
953134179 3:40168657-40168679 GCAGCTGATGTGCCCTCAGTTGG - Intronic
955219513 3:57012031-57012053 GCCCCTCAAGTTCCCTCAGAAGG - Intronic
957273582 3:78062335-78062357 GACCTTGATGTTCCCTCTGTAGG - Intergenic
957336993 3:78843478-78843500 CCCTCTGATGTTCCATCACTTGG + Intronic
965314893 3:167179186-167179208 GTCACCCATGTTCCCTCATTTGG - Intergenic
969895419 4:10299465-10299487 GGCACACATGTTCCCTCATTTGG - Intergenic
973008838 4:45046836-45046858 GTCACACATGTTCCCTCATTTGG + Intergenic
973878042 4:55241271-55241293 GCCTCTGACTTTCTCTCAGTGGG + Intergenic
975811349 4:78173376-78173398 GACACTGTTGTTCCCTCCCTAGG + Intronic
975913178 4:79293287-79293309 GACTCTGATCTTCCCTCATTCGG + Intronic
976977522 4:91182801-91182823 GTCACACATGTTCCCTCATTTGG - Intronic
977443423 4:97099109-97099131 GTCACACATGTTCCCTCATTTGG - Intergenic
980297770 4:130944520-130944542 GTCACACATGTTCCCTCATTTGG + Intergenic
981633431 4:146847932-146847954 ACCTGTGAAGTTCCCTCAGTGGG - Intronic
981784295 4:148460599-148460621 GAATCTGATGTTCCTTCAGTTGG - Intergenic
985290574 4:188382405-188382427 GCCACTGAATTTCCTTCAGTTGG + Intergenic
986916588 5:12626897-12626919 GCCACTGTTTTTCTCTTAGTTGG - Intergenic
988810874 5:34783983-34784005 GTCACACATGTTCCCTCATTTGG - Intronic
989535791 5:42562315-42562337 TCCACTGATGTTGGCTCAGTGGG - Intronic
993406241 5:87515119-87515141 GTCACACATGTTCCCTCATTTGG + Intergenic
994118772 5:96090711-96090733 TCCACAGAAGTTCCCTCAGAAGG - Intergenic
994208446 5:97061767-97061789 TCAACTGATGTTCCCCCAGCAGG + Intergenic
996856681 5:128016074-128016096 GCCACTGATGCTCCCTTTCTTGG + Intergenic
997508825 5:134439081-134439103 GCCTCTGCTGTTTCCTTAGTGGG - Intergenic
998716326 5:144889081-144889103 GCCACAGATGATGTCTCAGTAGG - Intergenic
1000881243 5:166700314-166700336 GCCACTGATTTCCTCTAAGTAGG + Intergenic
1001570341 5:172726721-172726743 GCCACAGCTGTTCCCTCTGCTGG + Intergenic
1003710062 6:8579373-8579395 GCCACTAGAGTTCCCTCTGTTGG + Intergenic
1005388730 6:25311885-25311907 GCCACTGATTTTGTCTCAGGAGG + Intronic
1006246208 6:32738944-32738966 GGCACTGATGGTACCTCATTAGG - Intergenic
1008243109 6:49136959-49136981 GCCCCTAATGTTCCCTAATTTGG - Intergenic
1010999158 6:82568393-82568415 GCTGCTGATGTGCCCTCAGCTGG + Intergenic
1012681988 6:102193980-102194002 GCCATTGCTGTTCCATCACTGGG - Intergenic
1013226841 6:108125303-108125325 GCCTCTGCTGTGCCCGCAGTTGG + Intronic
1020553040 7:9631926-9631948 GGCACTGGTATCCCCTCAGTTGG - Intergenic
1024101862 7:46040360-46040382 GTCACACATGTTCCCTCATTTGG - Intergenic
1024911568 7:54452948-54452970 GTCACACATGTTCCCTCATTTGG + Intergenic
1027916684 7:84333241-84333263 TCCATTGATGCTCCCTAAGTTGG + Intronic
1028582025 7:92418430-92418452 GCTGCTTATGTTTCCTCAGTGGG - Intergenic
1028779929 7:94724506-94724528 GTCACACATGTTCCCTCATTTGG - Intergenic
1030810223 7:113962660-113962682 TCCAAAGATGATCCCTCAGTTGG + Intronic
1030811649 7:113979854-113979876 GCCACTGATGCCCCTTCAGCTGG + Intronic
1032506780 7:132441491-132441513 CCCACTGATGTTCCCTAGCTAGG + Intronic
1034000928 7:147412292-147412314 GCCTCAGATGTTCTTTCAGTGGG + Intronic
1037439469 8:18900352-18900374 GTCACTGCAGCTCCCTCAGTAGG - Intronic
1037725494 8:21479554-21479576 GCCACACATGTTCCCTGAATTGG - Intergenic
1037899443 8:22678860-22678882 GCCCCTGCTGCTCCCTCACTAGG + Intergenic
1038521505 8:28236172-28236194 GCCTCTGTTGATACCTCAGTGGG - Intergenic
1038556912 8:28527205-28527227 GCCACTGGGGCTCCTTCAGTTGG - Exonic
1040609230 8:48966143-48966165 GTCACACATGTTCCCTCATTTGG + Intergenic
1042482041 8:69315085-69315107 TCCACTTGTGTTCCCTCGGTTGG - Intergenic
1043024371 8:75047881-75047903 GCCACACATGTTCCCTCATTTGG + Intergenic
1044442696 8:92240476-92240498 GTCACACATGTTCCCTCATTTGG + Intergenic
1047563224 8:126011862-126011884 GTCACACATGTTCCCTCATTTGG + Intergenic
1048049880 8:130806757-130806779 GCCATTGATGATCCCTCACCTGG + Intronic
1049653685 8:143788539-143788561 GCCACTGCTGCTTCCTGAGTAGG - Intergenic
1054537384 9:66245633-66245655 GCCACTGATCTCCACACAGTGGG + Intergenic
1054832768 9:69644802-69644824 GCCACTGATGGTTTCTCAGCAGG + Intronic
1055657582 9:78467157-78467179 GCTACTGATCTTCTCTCTGTAGG - Intergenic
1057500515 9:95593934-95593956 GACTCTGCTGTTCCCTAAGTTGG + Intergenic
1061735960 9:132659254-132659276 GACCCTCATGTGCCCTCAGTGGG - Intronic
1203736460 Un_GL000216v2:143436-143458 CCCACTGGTGCTGCCTCAGTTGG - Intergenic
1189779553 X:44501029-44501051 GTCACTTCTGTTCCATCAGTGGG - Intergenic
1191663314 X:63672549-63672571 GCTACTGAAGCTCCCTGAGTAGG + Intronic
1193314282 X:80046042-80046064 GTCACACATGTTCCCTCATTTGG + Intergenic
1196471977 X:116039025-116039047 GTCACACATGTTCCCTCATTTGG + Intergenic
1196825171 X:119735074-119735096 GCCCCTGCTGTGCCCTCTGTGGG - Intergenic
1196825322 X:119735995-119736017 GCCCCTGCTGTGCCCTCTGTGGG - Intergenic
1200062407 X:153489417-153489439 CCCACTGCTGTACCCTCAGATGG - Intronic
1200699548 Y:6390520-6390542 CCCACTTATGGTCCCACAGTGGG - Intergenic
1201034563 Y:9774178-9774200 CCCACTTATGGTCCCACAGTGGG + Intergenic
1201958984 Y:19657844-19657866 GTCACACATGTTCCCTCATTTGG - Intergenic