ID: 1161953036

View in Genome Browser
Species Human (GRCh38)
Location 19:7478219-7478241
Sequence CCCTGTGCAGGCCCATGCTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 340
Summary {0: 1, 1: 0, 2: 1, 3: 38, 4: 300}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161953036_1161953044 -7 Left 1161953036 19:7478219-7478241 CCCCAGCATGGGCCTGCACAGGG 0: 1
1: 0
2: 1
3: 38
4: 300
Right 1161953044 19:7478235-7478257 CACAGGGGTGGCTGCGAGCCGGG 0: 1
1: 0
2: 0
3: 27
4: 311
1161953036_1161953047 12 Left 1161953036 19:7478219-7478241 CCCCAGCATGGGCCTGCACAGGG 0: 1
1: 0
2: 1
3: 38
4: 300
Right 1161953047 19:7478254-7478276 CGGGATCCCACGCCTGCTGGAGG 0: 1
1: 0
2: 1
3: 13
4: 159
1161953036_1161953052 19 Left 1161953036 19:7478219-7478241 CCCCAGCATGGGCCTGCACAGGG 0: 1
1: 0
2: 1
3: 38
4: 300
Right 1161953052 19:7478261-7478283 CCACGCCTGCTGGAGGGAGTGGG 0: 1
1: 0
2: 1
3: 15
4: 224
1161953036_1161953050 18 Left 1161953036 19:7478219-7478241 CCCCAGCATGGGCCTGCACAGGG 0: 1
1: 0
2: 1
3: 38
4: 300
Right 1161953050 19:7478260-7478282 CCCACGCCTGCTGGAGGGAGTGG 0: 1
1: 0
2: 4
3: 46
4: 325
1161953036_1161953048 13 Left 1161953036 19:7478219-7478241 CCCCAGCATGGGCCTGCACAGGG 0: 1
1: 0
2: 1
3: 38
4: 300
Right 1161953048 19:7478255-7478277 GGGATCCCACGCCTGCTGGAGGG 0: 1
1: 0
2: 1
3: 12
4: 111
1161953036_1161953045 9 Left 1161953036 19:7478219-7478241 CCCCAGCATGGGCCTGCACAGGG 0: 1
1: 0
2: 1
3: 38
4: 300
Right 1161953045 19:7478251-7478273 AGCCGGGATCCCACGCCTGCTGG 0: 1
1: 0
2: 0
3: 5
4: 106
1161953036_1161953043 -8 Left 1161953036 19:7478219-7478241 CCCCAGCATGGGCCTGCACAGGG 0: 1
1: 0
2: 1
3: 38
4: 300
Right 1161953043 19:7478234-7478256 GCACAGGGGTGGCTGCGAGCCGG 0: 1
1: 0
2: 0
3: 18
4: 280

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161953036 Original CRISPR CCCTGTGCAGGCCCATGCTG GGG (reversed) Intronic
900299052 1:1967636-1967658 CCCTGTGGAGGCCAAAGCTGAGG + Intronic
900431409 1:2604778-2604800 CCCAGTGCAGGCCAATGCTCTGG + Intronic
900537341 1:3185428-3185450 CCCAGTGCATGTCCAGGCTGTGG + Intronic
900577694 1:3391830-3391852 CCCTGTGCACGCCTGTGCTTGGG - Intronic
901233897 1:7657151-7657173 TCTTGTGGAGCCCCATGCTGGGG + Intronic
901812677 1:11776764-11776786 CCCTGTGCAGGGCCACGGGGAGG - Intronic
902282473 1:15384480-15384502 CCCTCTGCCGTCCCATTCTGTGG - Intronic
902290495 1:15431794-15431816 TCTTGTGCAGACCCAGGCTGGGG - Intergenic
902401926 1:16162593-16162615 CCCAGTGCGGACCCAGGCTGAGG - Intergenic
902554830 1:17240769-17240791 CCTTGTGCAGGGTCCTGCTGGGG + Intronic
902680728 1:18042170-18042192 CCCTGTGCAGGCGGAGGCAGGGG + Intergenic
902876517 1:19343855-19343877 CCCTGAGAACGCCCAGGCTGAGG + Intronic
902993476 1:20205744-20205766 CCGTTTGGAGGCCTATGCTGAGG + Intergenic
903216547 1:21846492-21846514 CCCCGGGCAGGCCCATGCCCAGG - Exonic
903646012 1:24896922-24896944 CCCAGGGCAGGCCCTTTCTGTGG + Intergenic
904289266 1:29473666-29473688 CCATCTGCAGGCCCTTCCTGGGG + Intergenic
904450130 1:30605766-30605788 CCCTGTGAAGGTCCACTCTGTGG - Intergenic
904454519 1:30639288-30639310 CCCTGGGCAGACTCAGGCTGGGG + Intergenic
904457397 1:30655902-30655924 GCCTGTGCAGCAGCATGCTGAGG + Intergenic
904795814 1:33055592-33055614 CCCTCTGCAGCCCCAGCCTGGGG + Intronic
904966851 1:34380778-34380800 CTCTGTGCAGGCCCATTCCTGGG - Intergenic
906747371 1:48231460-48231482 CCCTGTGCATGGCCACACTGGGG - Intronic
907117521 1:51982165-51982187 CCCTGTGTAGGCCTAAGCTCAGG + Intronic
907271936 1:53296407-53296429 CCCTGTGCTGGCCCAGGCCTGGG - Intronic
910724200 1:90321435-90321457 CCCTTTGCAGCCTCATGTTGTGG - Intergenic
912501649 1:110126626-110126648 CCCTGTGGAAGCCCCTGCAGTGG + Intergenic
914859594 1:151374950-151374972 CACAGTGAGGGCCCATGCTGGGG + Intergenic
915012459 1:152700038-152700060 AACTGAGCAGGCCCATACTGAGG - Intergenic
915458962 1:156058305-156058327 CCCTCTGCAGGCCCAGGCTTTGG + Exonic
915915928 1:159940981-159941003 CACTGTGCAGGCACAGGCTGGGG + Intronic
917632969 1:176907976-176907998 CCCTTTACAGGCCCCTACTGAGG + Intronic
917979357 1:180259667-180259689 CTCTGTGGATGCCCGTGCTGGGG + Intronic
918399281 1:184147375-184147397 CCCTGTGCTCACCCATGCTTGGG - Intergenic
920021020 1:202956974-202956996 ACCTGTGAAGGCCCATGTTATGG - Intronic
922722375 1:227905544-227905566 CCCTGCCCAGGCCCTCGCTGTGG + Intergenic
924166810 1:241292023-241292045 CCCTGTGTAGGCCGAGGCTAAGG - Intronic
1064339702 10:14474988-14475010 CCCTGTACAGTCACATCCTGAGG - Intergenic
1065521672 10:26579697-26579719 CCCTGTGCGGGCCCTGCCTGGGG - Intergenic
1065559345 10:26946427-26946449 CCCTGCGCAGGCCCTGCCTGGGG + Intergenic
1066068050 10:31776735-31776757 CTCTGTGGAGGCCTCTGCTGAGG - Intergenic
1066310782 10:34193927-34193949 CCCTGTCCAAGCCCATGCCCAGG - Intronic
1067067738 10:43113161-43113183 GACTGTCCAGGCCCCTGCTGAGG + Intronic
1067806048 10:49394622-49394644 TCCTGAGCAGGGGCATGCTGAGG + Intronic
1069495584 10:68900912-68900934 GCGTGGGCAGGCCCATGCCGAGG - Intergenic
1070696947 10:78570701-78570723 CCCTGTGTAGACCCATCCTGTGG + Intergenic
1073098800 10:100996650-100996672 GCCTGGGCAGCCCCACGCTGAGG + Intronic
1073193865 10:101672228-101672250 GCCTGTGCAGGCCCTGGCTAGGG + Intronic
1073442489 10:103560642-103560664 CCCTGTGCATGCCCAGGGTGGGG - Intronic
1074291317 10:112139937-112139959 CCCTGTGCTGGTCCAGGCTCTGG - Intergenic
1074602729 10:114931599-114931621 CCCTCTATAGGCCCAAGCTGAGG - Intergenic
1074756505 10:116627804-116627826 CCGTGTGCGCGCCCAGGCTGTGG - Exonic
1074965668 10:118488839-118488861 CCCTTTGCTGACTCATGCTGGGG - Intergenic
1076055368 10:127368101-127368123 CCCTGTGAAGGGCCATGTTCTGG - Intronic
1076822434 10:132946194-132946216 ACCTGTGCAGGGCCAGGCTCTGG + Intergenic
1076854002 10:133106396-133106418 CCTTTTCCAGGCCCAAGCTGTGG + Intronic
1076913025 10:133401828-133401850 CACTGTCCAGGGCCATGCAGTGG + Intronic
1077151874 11:1076417-1076439 GCCTGCCCATGCCCATGCTGGGG - Intergenic
1077220085 11:1411900-1411922 CCCTGTGCTGCCCCATCCTGTGG + Intronic
1077228684 11:1449246-1449268 GCCTGGGCAGGGCCAGGCTGGGG - Intronic
1078019096 11:7640559-7640581 CCCTGAGCTGGCCCATGCATTGG + Intronic
1078719777 11:13873623-13873645 CCCAGGGCAGACCCCTGCTGAGG + Intergenic
1079004354 11:16781640-16781662 CTCTGTGCAGGATCAGGCTGTGG + Intronic
1080271194 11:30452364-30452386 CCCTGCCCAGGCCCATCCTGTGG + Intronic
1080845685 11:36024789-36024811 CCTTCTGCAGCCCCATGTTGAGG + Intronic
1083628832 11:64085588-64085610 CGCTGTGCTGGCCCACGCTGCGG - Intronic
1083731936 11:64656996-64657018 CCCTCTTCAGGCCCAGCCTGGGG + Intronic
1084396169 11:68911920-68911942 CCGTGTGCACGCCCGTGCAGGGG + Intronic
1084485127 11:69443639-69443661 CCTTCTGCCGGGCCATGCTGCGG + Intergenic
1086839992 11:91673258-91673280 TCCTGTGCTGGACCATGCTGTGG + Intergenic
1087237006 11:95731339-95731361 TCCTGTACCTGCCCATGCTGAGG + Intergenic
1088386896 11:109268508-109268530 TCCTCTGCAGTCCCATGATGTGG - Intergenic
1089324579 11:117648306-117648328 CCTTGAGCCGGCCCCTGCTGGGG - Intronic
1089715370 11:120353942-120353964 CCCTGTGCTGGGTGATGCTGGGG + Intronic
1090408050 11:126489135-126489157 TCCTGCTCAGCCCCATGCTGAGG - Intronic
1091318912 11:134635968-134635990 CCCTGGGCATTGCCATGCTGGGG + Intergenic
1091721983 12:2820482-2820504 CCCTGTGCATGTCCCAGCTGGGG - Intronic
1092341373 12:7679265-7679287 GGCTGTGCACGCCCAGGCTGGGG - Intergenic
1092427411 12:8385921-8385943 CCCAGTTCACTCCCATGCTGGGG - Intergenic
1096292124 12:50351962-50351984 CCCTCAGCAGGCCCAGGCTCTGG - Exonic
1096661068 12:53124307-53124329 CCCTGGTCACCCCCATGCTGAGG - Exonic
1099980164 12:89590698-89590720 CACTGTTCAGGACCATGCTTGGG + Exonic
1101654057 12:106704554-106704576 CCCTGGGCAGGCCCAGGCTGAGG + Intronic
1102419626 12:112793507-112793529 GCCTGAGCAGGCACATGCTGTGG - Intronic
1102561800 12:113767454-113767476 CCTGGTGCAGGCCCATGCCCTGG + Intergenic
1103459186 12:121090141-121090163 CCCTCTGCAGGCCCAGCCTGGGG + Intergenic
1105038848 12:132946363-132946385 CCCTGGGCAGACGCAGGCTGGGG + Intronic
1105516224 13:21093344-21093366 CTCTGTCCAGACCCTTGCTGTGG + Intergenic
1106411636 13:29515074-29515096 CCGTGTGCAGGAACAGGCTGTGG - Intronic
1107568180 13:41628114-41628136 CTATGCTCAGGCCCATGCTGTGG + Intronic
1107721284 13:43251007-43251029 CACTGGGCAGGTCCAAGCTGGGG - Intronic
1112589729 13:100751905-100751927 CCCTGTGCCAGCCGGTGCTGGGG + Intergenic
1113739210 13:112699752-112699774 CCCTGTGCAGCCTCCTGCCGGGG + Intronic
1114484662 14:23055644-23055666 CCCTGCCCAGGCCCGGGCTGGGG + Exonic
1117322547 14:54637585-54637607 CCCTGTGCTGACACATGGTGCGG - Intronic
1117793109 14:59361772-59361794 CCCAGAGCAGGCCCAAGCTATGG - Intronic
1117958467 14:61140724-61140746 CCATGGGCATGCACATGCTGTGG + Intergenic
1118748304 14:68789739-68789761 CCCCGGGCAGCCCCATGCTAGGG + Exonic
1119587709 14:75852208-75852230 TCCTGTGCAGACCCGTGGTGTGG + Intronic
1121891445 14:97595445-97595467 CCCTGTGCATCCCCATTCTTGGG - Intergenic
1122093865 14:99357253-99357275 ATCTGGGCAGGCCCATGGTGTGG + Intergenic
1122274043 14:100582059-100582081 ACCTCTGCTGGCCTATGCTGCGG - Intronic
1122654723 14:103250380-103250402 CCCTGTAGAGCGCCATGCTGTGG - Intergenic
1122919031 14:104872079-104872101 TCCTGTGGTGGCCCAGGCTGTGG + Intronic
1123044177 14:105503336-105503358 CACTGTGCAGGCCCAGGCTCAGG - Intergenic
1123055229 14:105566294-105566316 CCATGTCCAGGCCAATGCTGTGG - Intergenic
1123079678 14:105686138-105686160 CCATGTCCAGGCCAATGCTGTGG - Intergenic
1124083103 15:26519173-26519195 CCATGTGAAGGACCCTGCTGGGG - Intergenic
1124597475 15:31102779-31102801 CCCTTTGCACGCCCACTCTGCGG - Intronic
1128075627 15:64823792-64823814 GCCTGTGGAGCCCCAGGCTGGGG - Exonic
1128600550 15:68991982-68992004 GCCTGAGCAGGCCTAGGCTGCGG - Intronic
1128999116 15:72318717-72318739 CCCAGTCCAGGCCCATTCTCAGG - Intronic
1129329584 15:74820229-74820251 CCTTGTGCAGGGCAGTGCTGCGG + Intronic
1129748965 15:78046916-78046938 CACAGTGCAGGCCCATCATGTGG - Intronic
1130068459 15:80626647-80626669 CCCTGTGCAGGCCCTGGGTATGG + Intergenic
1132399435 15:101496425-101496447 CCCTCTGCAGGGTCATGCTCTGG + Intronic
1133219154 16:4311489-4311511 CCCTGGGCAGGACCTTGCAGGGG + Intergenic
1133413752 16:5589850-5589872 CCCTCTGCAGGCCAAGGCAGTGG - Intergenic
1137581485 16:49636190-49636212 CCGTGTCCAGGCTCTTGCTGTGG + Exonic
1138584442 16:57960903-57960925 CCCTCTGCAGGCCTGGGCTGCGG - Exonic
1139697608 16:68686195-68686217 CCCTGTGCAGGCCACTGATGCGG - Intronic
1141304219 16:82845801-82845823 CCCTGAGCAGGCACATCCTCTGG + Intronic
1141448559 16:84080642-84080664 ACCAGGGCAGGCCCATTCTGGGG + Intronic
1141657027 16:85421904-85421926 CCTCTGGCAGGCCCATGCTGAGG + Intergenic
1141722245 16:85763010-85763032 TGGTGTGCAGGCCCCTGCTGGGG + Intergenic
1141862442 16:86727168-86727190 ACCTGTGCAGGTGCAGGCTGAGG + Intergenic
1142156699 16:88535588-88535610 CCCTGTGGTGGCCAAGGCTGGGG + Exonic
1142282046 16:89153799-89153821 CTCTGTGCAGGCCTATCCTCAGG + Intronic
1142478686 17:204851-204873 ATCTGGGCAGGCCCCTGCTGTGG + Intergenic
1142600680 17:1052234-1052256 CCCTGGTCTGGCCCAGGCTGGGG - Intronic
1142695321 17:1629731-1629753 CCCTCTGCAGGGCGATGCTACGG + Intergenic
1142932482 17:3298780-3298802 CACTGTGCAGGCCTGTGCTCCGG + Intergenic
1145120138 17:20251614-20251636 GCCTGTGCAGGGCCATTCTGAGG - Intronic
1146374867 17:32287261-32287283 CCCTGTGCAGGTGCATCCTCAGG + Intronic
1148441746 17:47715068-47715090 CCCTGCCCAGGGCCCTGCTGTGG - Intergenic
1150011017 17:61503800-61503822 CCCTGTGTAGGCCTAGGCTAAGG - Intergenic
1150908256 17:69361631-69361653 TCCTTTGCAGGACCATTCTGAGG + Intergenic
1151835926 17:76582755-76582777 CCATTTGCAGTCCCAAGCTGGGG + Intronic
1151911269 17:77084880-77084902 CCCTGTGCAGGGGGATACTGTGG + Intergenic
1151935430 17:77258078-77258100 CCCTGTGCGGGCACCTGCAGAGG - Intergenic
1152204586 17:78967754-78967776 CCCACTGCAGTCCTATGCTGGGG + Intergenic
1152438017 17:80288069-80288091 CCCCCTGCAGGCCCAGGCTTTGG + Exonic
1152562448 17:81085365-81085387 TCCTCTGCTGTCCCATGCTGGGG - Intronic
1152963563 18:95791-95813 CGCTGTGCAGACCCAGGCTGGGG + Intergenic
1153618073 18:6952289-6952311 CCCTGTGCAGCTACATGGTGCGG - Intronic
1154001438 18:10485545-10485567 CCCCGTGCAGGCCGATGGTCAGG - Exonic
1155117501 18:22783974-22783996 CACTGTGCAGGGCCTTCCTGTGG - Intergenic
1156507720 18:37609072-37609094 CCCTGCGCATGCCCAGCCTGAGG - Intergenic
1157017577 18:43735827-43735849 CCCAATGCAGTCACATGCTGAGG + Intergenic
1157515122 18:48305365-48305387 CCCTGAGCAGAACCATCCTGGGG - Intronic
1158536995 18:58317212-58317234 CCCTGGGCAGGCCCCTCCCGTGG - Intronic
1160128891 18:76206139-76206161 CCCTGGGCTGGCTCATCCTGAGG - Intergenic
1160777254 19:861997-862019 CCCTCTGCAGGCCCTTCCCGGGG - Intronic
1161073445 19:2273709-2273731 CCATGCGCAGGCCCAGGCTGGGG - Intronic
1161578563 19:5068140-5068162 CCCTGCTCGGGGCCATGCTGGGG - Intronic
1161953036 19:7478219-7478241 CCCTGTGCAGGCCCATGCTGGGG - Intronic
1162561646 19:11421035-11421057 CCCTGTTCAGGGCCAAGGTGGGG - Intronic
1162872886 19:13599507-13599529 CCCTGAGCTGCCCCAGGCTGAGG - Intronic
1163552765 19:17974569-17974591 CCCAGAGCAGGCCCACTCTGGGG - Intronic
1163770578 19:19188709-19188731 TCCTGTGCAGGCCCAGGATGAGG + Intronic
1165402699 19:35612092-35612114 CCCTGTGCTGGGTGATGCTGGGG - Intergenic
1165784252 19:38451917-38451939 TCCTGTGCTGTCCCATGCTCCGG + Intronic
1166305327 19:41934351-41934373 CCGTGTGCCTGCACATGCTGTGG + Intergenic
1166345488 19:42162747-42162769 CCCTGTGCTGGGCAATGCTTCGG - Intronic
1166561272 19:43733880-43733902 CTCTGTGTAGGGCAATGCTGGGG + Intronic
1166872821 19:45881297-45881319 CCCTGTGCTGGGTGATGCTGGGG + Intergenic
1167263441 19:48471503-48471525 TCCTGTGTAGGGCAATGCTGGGG + Intronic
1167321356 19:48799058-48799080 CCCTGTGCTGGCAGAAGCTGGGG - Intronic
925278518 2:2667295-2667317 CATTCTGCAGGCCCATGCTGAGG + Intergenic
926217518 2:10914462-10914484 CCCCCTGCAGGCCCAGGATGGGG + Intergenic
926728909 2:16020010-16020032 CCCTGTGCAGGTTCATGGAGTGG + Intergenic
927467952 2:23351083-23351105 CTCTTTACAGGGCCATGCTGAGG + Intergenic
930724522 2:54669551-54669573 CCCTGTTCAGGCCCAGCCTCTGG - Exonic
932481209 2:72040492-72040514 CCCACTGCAGAACCATGCTGTGG + Intergenic
935111558 2:100099008-100099030 GCCCCTCCAGGCCCATGCTGAGG + Intronic
936123410 2:109766156-109766178 GCCCCTCCAGGCCCATGCTGAGG - Intergenic
936221275 2:110605308-110605330 GCCCCTCCAGGCCCATGCTGAGG + Intergenic
937089488 2:119196397-119196419 CCATGAGCAGCCCCATGATGAGG - Intergenic
942104630 2:172620510-172620532 TCCTATGCAGGCTCATTCTGTGG + Intergenic
943347540 2:186757200-186757222 CTCTGGGCAGGCTCATGCTTGGG - Intronic
943926554 2:193791235-193791257 CCCTCTGCAGCTCCATGCTATGG + Intergenic
945237164 2:207641948-207641970 TCCTGAGCAGCCCCAGGCTGTGG + Intergenic
946109149 2:217398911-217398933 CCCTGAGCAGGCCCCGACTGTGG - Intronic
946483024 2:220074811-220074833 CTCTATCCAGGCCCATCCTGAGG + Intergenic
947139791 2:227010371-227010393 CCCTGGGCATGCCCAGGCTCTGG - Exonic
948202111 2:236136638-236136660 CCCTGTGCGAGCCCAGGCTGGGG - Intergenic
948570197 2:238912993-238913015 CCCTGTGCTGGCTCCTGCTCTGG + Intergenic
948696376 2:239735029-239735051 CCCTATGCAGGAGCATGCAGAGG + Intergenic
948747863 2:240109076-240109098 CCCTGAGCAGGGACATGGTGGGG - Intergenic
948928731 2:241116821-241116843 ACCTGAACAGGCCCATCCTGTGG - Intronic
948990111 2:241549638-241549660 CCCCGTTCAGGCCGAGGCTGCGG + Intergenic
949045996 2:241872920-241872942 CCCTCTGGAGGCCAATGCCGAGG + Exonic
1170776166 20:19376551-19376573 CCCTTGGCTGGCTCATGCTGGGG - Intronic
1171970191 20:31559667-31559689 CCCTGGAGAAGCCCATGCTGGGG - Intronic
1173084680 20:39904482-39904504 CCCCATGCAGGGCCCTGCTGGGG + Intergenic
1173595911 20:44258310-44258332 CCCTGGGCACCCCCATGCTCGGG - Intronic
1173969069 20:47137049-47137071 TCCTGGGAAGGACCATGCTGGGG - Intronic
1174776178 20:53345235-53345257 ACCTGTGCTGTCCCCTGCTGAGG - Intronic
1175172845 20:57092196-57092218 CTCTCTGCAGGCCCTTGCGGAGG - Intergenic
1175593411 20:60211857-60211879 CCCTGTGCGCACCCACGCTGGGG + Intergenic
1175944330 20:62551650-62551672 GTCTGTGCAGGTCCCTGCTGGGG + Intronic
1175977424 20:62718045-62718067 CCCAGGGCAGGCACGTGCTGGGG + Intronic
1176906743 21:14510374-14510396 CCCTATTCAGGACCATTCTGTGG - Exonic
1177530012 21:22346396-22346418 ACATTTGGAGGCCCATGCTGAGG - Intergenic
1178828468 21:36035113-36035135 TCCTGTTCAGGCCCGTGCTGGGG - Exonic
1179247261 21:39644838-39644860 CCCTGGGGAGGCCAGTGCTGGGG - Intronic
1179618251 21:42595570-42595592 CACCTTGCAGGCCCATGCTGTGG + Intergenic
1179794661 21:43776077-43776099 CCCTGGGCTGGCCCGGGCTGTGG - Intronic
1179939899 21:44630521-44630543 CCCCATGCATGCCCATGATGGGG + Intronic
1180639700 22:17288450-17288472 CCCTGTGCTGGCCCCTGCCTAGG + Intergenic
1180921136 22:19522279-19522301 ACCTGTGCCAGCCCCTGCTGGGG - Intergenic
1181036194 22:20170825-20170847 CCAAGTGCAGGCCCAGGCAGAGG + Intergenic
1181359411 22:22323271-22323293 TCCTGTGCCTGCCCATGGTGTGG + Intergenic
1181369508 22:22405022-22405044 TCCTGTGCCTGCCCATGGTGTGG + Intergenic
1182033504 22:27179498-27179520 TCCTGTGCAGGCCCAGAGTGGGG + Intergenic
1183305545 22:37081162-37081184 CTCTGGGCAGGCACAAGCTGAGG - Intronic
1183417180 22:37689138-37689160 CTCAGTGCTGGCCCATGTTGTGG + Intronic
1183742647 22:39677430-39677452 CCCAGAGCAGGCCCGTGGTGGGG + Intronic
1183951279 22:41354464-41354486 CCCTGGGCAGGGCAATGCTGGGG + Intronic
1184128700 22:42504563-42504585 CCCTCTGCAGCCCCAGGCAGTGG + Intergenic
1184137495 22:42557878-42557900 CCCTCTGCAGCCCCAGGCAGTGG + Intronic
1184161610 22:42700550-42700572 CCCTGTGCGTGGCCAGGCTGGGG + Intronic
1184727509 22:46355466-46355488 CCCTGTACAGGGACCTGCTGAGG + Exonic
1184763196 22:46557247-46557269 CCTTATGCAGGGCAATGCTGGGG + Intergenic
1184977319 22:48071627-48071649 CCCTGCGCAGACCCCTCCTGTGG + Intergenic
1185063062 22:48617039-48617061 CCCTGTGCAGACCCAGCGTGTGG + Intronic
1185163593 22:49244220-49244242 CCCTGTGCAGGGTCCTGCTCGGG - Intergenic
1185357265 22:50381219-50381241 CCGTGTGGTGCCCCATGCTGAGG - Intronic
949213531 3:1536126-1536148 CTCTGAGTAAGCCCATGCTGAGG - Intergenic
949487088 3:4550208-4550230 CTCTGAGCAGGGCCATGTTGGGG + Intronic
950576960 3:13837797-13837819 ACCTGGGCAGGGCCTTGCTGGGG - Intronic
953725459 3:45394101-45394123 CCCTGGGCTGGCCCATGGGGAGG + Intronic
954372591 3:50176581-50176603 CCCAGGGCAGGGCCATGCTGTGG - Intronic
955401081 3:58591990-58592012 CCCTGAGCAGGCCACAGCTGAGG - Intronic
959727342 3:109559698-109559720 CCCTGGGCAGGCACAAGTTGTGG + Intergenic
961508737 3:127388475-127388497 CCTTGGCCAGGCCCAGGCTGGGG - Intergenic
961528532 3:127525043-127525065 CCAAGTGCAGTCCCATTCTGAGG - Intergenic
961529949 3:127534275-127534297 CCCAGGGGAGGCCCATCCTGTGG + Intergenic
961772295 3:129258816-129258838 CTCTGTGCAGGGCCCTGCTCTGG + Intronic
962713189 3:138104314-138104336 CACTGTGCAGGCCTGTGGTGAGG + Intronic
962809570 3:138949116-138949138 CCCTGCCCAGGCCCTGGCTGGGG - Intronic
962839196 3:139218291-139218313 CCCTGTGCAGGCCTGTGCAAAGG - Intronic
964032702 3:152155848-152155870 CCCACTGCAGCCCTATGCTGTGG + Intergenic
964475965 3:157097793-157097815 CCATGTCCAGGCTCATGCTTGGG - Intergenic
964555406 3:157931710-157931732 CGATGTGCAGGCCCACCCTGAGG - Intergenic
966091604 3:176144989-176145011 TCCTGAGCAGGCCAAGGCTGTGG - Intergenic
966887698 3:184386036-184386058 CTATGTGCAGGCCCAGGGTGTGG + Exonic
967922296 3:194622478-194622500 CCCTGTGTCGGCCAGTGCTGGGG - Intronic
968531025 4:1091734-1091756 CCCTGTGCAGCCCCATCCTCTGG - Intronic
968684999 4:1952135-1952157 CTCTGTGAAGGACCCTGCTGCGG + Exonic
968727600 4:2255565-2255587 CCCAGTGCAGCCCCGGGCTGAGG - Intronic
968880099 4:3294189-3294211 TCCTGTGCAGGGCCCTTCTGAGG + Intronic
968957779 4:3728010-3728032 CCCTGTGCAGGGAGAGGCTGGGG - Intergenic
969015709 4:4102937-4102959 CCCAGTTCACTCCCATGCTGGGG - Intergenic
969928310 4:10606249-10606271 CCCTATGCAGGCCTAGGCTAAGG - Intronic
971032238 4:22652173-22652195 TCCTTTGCAGTACCATGCTGGGG - Intergenic
971266890 4:25103598-25103620 CCCTTTCCTGGCCCTTGCTGCGG - Intergenic
977809739 4:101346166-101346188 TCCTGTGCAGGCCCTTCCAGGGG + Intronic
980228889 4:130022346-130022368 CTCTGTGCAGGCCAAGCCTGGGG + Intergenic
980974911 4:139601220-139601242 CCCTCTGCACGCCCAAGCAGCGG - Intronic
982116854 4:152105200-152105222 CCCTCTGCAGAGCCAGGCTGGGG + Intergenic
982461478 4:155674605-155674627 CCTTGTGTAGGTCCATGCTAAGG - Intronic
982819263 4:159926266-159926288 GCCTGAGCAGGCCTAGGCTGCGG - Intergenic
984449710 4:179883641-179883663 CTCTGTTCAGGCCTGTGCTGTGG + Intergenic
985630714 5:1012631-1012653 CCGTGAGCAAGGCCATGCTGAGG - Intronic
985974194 5:3402399-3402421 CCCTGTGTAGGCCCAGACTAAGG + Intergenic
986061059 5:4191801-4191823 CCATGTGCAGGGCCTTTCTGAGG + Intergenic
986447439 5:7834241-7834263 CCCTGTGTAGGCCGAGGCTAAGG + Intronic
991984837 5:72274398-72274420 CCCTGTGCAGGCCTAAGCTAAGG - Intronic
992019938 5:72612598-72612620 GCCACTGCAGGCCCAAGCTGTGG - Intergenic
993554203 5:89315397-89315419 CCCTGCGCAGGCGGGTGCTGTGG - Intergenic
997697296 5:135871747-135871769 CCCTGTGCAGGCCACAGCAGTGG + Intronic
997882410 5:137602524-137602546 CCTTGTGCAGGCCCTTGGTGAGG - Intergenic
1002189125 5:177469774-177469796 CCCCATGCAGGCCCAGGCTGAGG + Intronic
1002503703 5:179664554-179664576 GCCTGTGCAGGCCCAGCCTGGGG + Intergenic
1002641068 5:180630900-180630922 CCCTGGGCAGTTCCATGCTCTGG - Intronic
1002774117 6:314297-314319 CTCTGGGCAGCCCCAGGCTGGGG + Intronic
1003193644 6:3895721-3895743 CCCTGTGCAGCCACATGTTTAGG - Intergenic
1004076100 6:12345480-12345502 CCCTGTTCTGGCCGAAGCTGAGG - Intergenic
1004205820 6:13591461-13591483 CCCTGGGCAGTCCCAGGATGGGG + Intronic
1005357086 6:24995221-24995243 CTCTGTGCACTCCCAGGCTGAGG - Intronic
1007079993 6:39093324-39093346 CACTGGGGAGTCCCATGCTGAGG + Intergenic
1007369278 6:41415564-41415586 CCCTGTGCCAGGCCCTGCTGTGG + Intergenic
1008296177 6:49781188-49781210 CCCTCTGTAGGCCCAGGCTAAGG - Intergenic
1011567650 6:88694858-88694880 CTTTGTGCTGGGCCATGCTGTGG - Intronic
1011626865 6:89290297-89290319 CCCTGTGCAGGGACCTGCTGTGG - Intronic
1012307093 6:97672187-97672209 TCAGGTCCAGGCCCATGCTGAGG - Intergenic
1013287169 6:108691458-108691480 CCCTGGGCATGGCCAAGCTGAGG - Intergenic
1015460223 6:133482389-133482411 CAGAGTGCAGGCCCATTCTGAGG + Intronic
1016312673 6:142751216-142751238 TGCTGCCCAGGCCCATGCTGAGG + Intergenic
1018576344 6:165264049-165264071 CTGTGTGCAGGCCAGTGCTGGGG - Intergenic
1019188827 6:170238304-170238326 CCCTGCACAGGCCCTTTCTGAGG - Intergenic
1019643697 7:2118013-2118035 TCCTGTCCTGCCCCATGCTGAGG - Intronic
1021628891 7:22624033-22624055 GACTGTGCAGCCCCAAGCTGGGG - Intronic
1023740724 7:43278494-43278516 CTTTGAGAAGGCCCATGCTGGGG - Intronic
1024161630 7:46682146-46682168 TCCTGTGCCGGCCCTTGCTTTGG - Intronic
1025071395 7:55902556-55902578 CCCTGTTCAGGCCCAGGCTCTGG - Intronic
1026941077 7:74288453-74288475 CCCTGTCCATGCCCAGGCTGCGG - Intergenic
1029751980 7:102548284-102548306 GCCTGAGCAGGGCCATGGTGAGG - Intronic
1029769932 7:102647378-102647400 GCCTGAGCAGGGCCATGGTGAGG - Intronic
1032665562 7:134032793-134032815 ACCTATGCAGGCACATGGTGAGG - Intronic
1034375673 7:150641851-150641873 CCATGTGCAGGACCATTCTCTGG - Intergenic
1035021683 7:155804272-155804294 CCCTCCGCAGGCCCACGCCGAGG - Intronic
1035126404 7:156611035-156611057 CCCAGTGCAGTCCGATGCTTTGG - Intergenic
1035246681 7:157566849-157566871 CCCTGTGGAGACGCACGCTGGGG + Intronic
1035358375 7:158293788-158293810 CCCTGTGTAGGCCTAGGCTAGGG - Intronic
1035952268 8:4035550-4035572 CCCCGTGCAGGCCTAGGCTAGGG + Intronic
1036007837 8:4687080-4687102 CCCTGTGCAGGCTAACTCTGTGG + Intronic
1036496816 8:9277382-9277404 CCCTGTGCAGCCACAGCCTGGGG + Intergenic
1037856049 8:22371138-22371160 CCTTGGGCAGGCCAATTCTGTGG - Intronic
1038753384 8:30317345-30317367 CTCTGTGCCGCCCCATGCTTAGG - Intergenic
1040323169 8:46328614-46328636 CCCTGGGCAGCCCCAGGGTGGGG - Intergenic
1040834832 8:51720828-51720850 CCCTGTGCAGGCTCCTGCCTAGG + Intronic
1041120305 8:54579837-54579859 CCGTGTGCAGGCTGATTCTGAGG - Intergenic
1042901422 8:73732211-73732233 CGATGGGGAGGCCCATGCTGTGG - Intronic
1047219863 8:122910717-122910739 CAGTGTGCAGGCCCCTGCTGGGG + Intronic
1047248037 8:123161135-123161157 CCCGGCGCAGGCGCAGGCTGAGG - Intergenic
1048170051 8:132097571-132097593 CCCAGTGCAGGGCCTTGCAGAGG + Intronic
1049605346 8:143526694-143526716 CCCTGTTTAGTCCCCTGCTGGGG - Intronic
1049614333 8:143569507-143569529 CCCTGAGGAGGCTCCTGCTGCGG - Exonic
1049670689 8:143868463-143868485 CCCTGAGGAGGCACATCCTGCGG - Exonic
1049814727 8:144592860-144592882 CCCTGTGCAGAGCCAGCCTGCGG - Intronic
1050461035 9:5877555-5877577 CCCTGCCCAAGCCCATGGTGTGG - Intergenic
1050598080 9:7224079-7224101 CCCTGTTCCGGGCCAGGCTGGGG - Intergenic
1054852343 9:69860785-69860807 CCCTGTGTAGGCCTAGGCTAAGG - Intronic
1055086705 9:72321416-72321438 CACTGTGCAGGCCTAGGCTAAGG + Intergenic
1055797138 9:79987329-79987351 CCCTGTGCAGACGGATGCTTTGG - Intergenic
1056689832 9:88798668-88798690 CCCAGTCAAGGCCCTTGCTGTGG + Intergenic
1056825138 9:89872046-89872068 CCCGGTGGGGGCCCATCCTGTGG + Intergenic
1057207989 9:93184701-93184723 CCCTGCTCAGCCCCAGGCTGCGG - Intergenic
1058928065 9:109688501-109688523 CCCTTTGCAGGGCTATTCTGAGG - Intronic
1060774890 9:126365822-126365844 CCCAGTACAGGCCCGTGGTGGGG - Intronic
1060927873 9:127467887-127467909 CCCTGTGCCAGCCCAGGCTGGGG + Intronic
1062323302 9:136001045-136001067 ACAGGTGCAGGCCCCTGCTGGGG + Intergenic
1062394326 9:136346659-136346681 TCCCTTACAGGCCCATGCTGCGG - Intronic
1062402307 9:136378027-136378049 CCCTTCTCAGGCCCAGGCTGGGG + Exonic
1062734533 9:138127935-138127957 CGCTGTGCAGACCCAGGCTGGGG - Intergenic
1185462989 X:340903-340925 CCCCGTCCAGGTCCATGCAGCGG + Exonic
1185644687 X:1608575-1608597 CCCTGTGCAGGCCGATCCAGTGG - Intergenic
1195094365 X:101490947-101490969 CTCTGTCCAGCCCCAGGCTGTGG + Exonic
1200223684 X:154404866-154404888 CCCTGAGCAGCCCCCAGCTGGGG - Exonic