ID: 1161953838

View in Genome Browser
Species Human (GRCh38)
Location 19:7482212-7482234
Sequence CTGCAGGACCAGGAGCAGAG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 621
Summary {0: 1, 1: 0, 2: 4, 3: 66, 4: 550}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161953828_1161953838 16 Left 1161953828 19:7482173-7482195 CCCTAGGACGGAGACACAGCGGA 0: 1
1: 0
2: 0
3: 3
4: 66
Right 1161953838 19:7482212-7482234 CTGCAGGACCAGGAGCAGAGGGG 0: 1
1: 0
2: 4
3: 66
4: 550
1161953826_1161953838 23 Left 1161953826 19:7482166-7482188 CCAGGTTCCCTAGGACGGAGACA 0: 1
1: 0
2: 0
3: 7
4: 83
Right 1161953838 19:7482212-7482234 CTGCAGGACCAGGAGCAGAGGGG 0: 1
1: 0
2: 4
3: 66
4: 550
1161953829_1161953838 15 Left 1161953829 19:7482174-7482196 CCTAGGACGGAGACACAGCGGAC 0: 1
1: 0
2: 1
3: 6
4: 68
Right 1161953838 19:7482212-7482234 CTGCAGGACCAGGAGCAGAGGGG 0: 1
1: 0
2: 4
3: 66
4: 550

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161953838 Original CRISPR CTGCAGGACCAGGAGCAGAG GGG Intronic
900220038 1:1503561-1503583 CTGCAGGCACAGGGGCACAGAGG - Intergenic
900341125 1:2189860-2189882 CTCCAGCGGCAGGAGCAGAGAGG - Intronic
900479950 1:2893199-2893221 GTCCAGGCCCTGGAGCAGAGTGG - Intergenic
900578018 1:3393945-3393967 CTGCAGGTCCAGGGCCAGGGAGG + Intronic
900661945 1:3789154-3789176 CTGCAGCACCAGGAACAGTGCGG + Intronic
901169812 1:7248465-7248487 CTGCACGTTCAGGTGCAGAGTGG + Intronic
901689192 1:10961385-10961407 CTGAAGGAGCAGGGGCTGAGCGG - Intronic
901919788 1:12527907-12527929 CTGGAGGGCCTGGAGCAGAGGGG - Intergenic
901936636 1:12631253-12631275 CTGGATGACCAGCTGCAGAGAGG + Intergenic
902225998 1:14996794-14996816 CTGGAGCACCAGGAGCGGGGAGG - Intronic
902242866 1:15100361-15100383 CTGCTGCCCCAGGAGCAGGGTGG + Intronic
902412481 1:16219515-16219537 CCAGAGGACCAGGAGCAGTGGGG - Intergenic
903211894 1:21823361-21823383 CTGCAGGTCCAGGGGCTGTGGGG + Exonic
903810079 1:26030462-26030484 AGCCAGGACCTGGAGCAGAGAGG - Exonic
905012606 1:34757590-34757612 GTGCATGACCACGAGCAGTGAGG - Exonic
905013352 1:34761514-34761536 GTGCATGACCACGAGCAGTGAGG - Exonic
905188287 1:36212803-36212825 CTGCTGACCTAGGAGCAGAGTGG - Intergenic
905276467 1:36821726-36821748 CTGGAGGACCAGGGGCTGTGTGG + Intronic
905586078 1:39119683-39119705 AGGCAGGTCCAGGAGCAGGGAGG - Intronic
905633424 1:39531795-39531817 GTGCAGGGGCAAGAGCAGAGTGG + Intergenic
905660517 1:39719697-39719719 CTGCAGGACCAGAGGCATACAGG + Intronic
905872698 1:41414314-41414336 CTGCAGCCCCAGGAGCAGGAGGG + Intergenic
906537335 1:46558784-46558806 CTGCAGGAACAGCAGCACAATGG - Exonic
906544855 1:46613688-46613710 CTGCAGGCCCACCAGCAGACAGG + Intronic
906614630 1:47225787-47225809 CAGCAGGACCAGGTGCGGGGGGG + Exonic
907477307 1:54714370-54714392 CTGCAGGACCAAGGTCAGTGAGG + Intronic
907504948 1:54911299-54911321 TTGCTGGATCAGGAGCACAGTGG + Intergenic
907515948 1:54993611-54993633 CAGCAGGGCCAGGGGCAGGGTGG - Intergenic
907761847 1:57368505-57368527 CTGGATGACCAGCTGCAGAGAGG + Intronic
907803331 1:57793507-57793529 CCTCAGTACCAGCAGCAGAGAGG - Intronic
908776468 1:67645787-67645809 CTGCAGAAGCTGGAGCAAAGTGG + Intergenic
908809014 1:67960085-67960107 CAGCAGGATCAGGAGGGGAGTGG - Intergenic
910631390 1:89358565-89358587 CTGCAGCACCAGGAGCCCATTGG - Intergenic
910676710 1:89822164-89822186 CTGCAGGTCGAGGGGAAGAGAGG + Intronic
910677453 1:89828895-89828917 CTGCAGAACAAGGAGAAGAAAGG + Intronic
911232628 1:95377068-95377090 GTGCAGGCACAGCAGCAGAGAGG + Intergenic
911368957 1:96973745-96973767 GTGCAGGATCAGTAGCACAGAGG - Intergenic
912939877 1:114035361-114035383 TGGCAGGACCAAGAGGAGAGTGG + Intergenic
914337235 1:146726082-146726104 AGGCAGAATCAGGAGCAGAGTGG + Intergenic
914434403 1:147647550-147647572 CTGCAGGAGCAGGTGCCGAGAGG - Exonic
915025747 1:152827869-152827891 TTGCAGGCCCAGGAGGAGACAGG - Exonic
915285937 1:154852017-154852039 GTGCAGGCCTGGGAGCAGAGAGG - Intronic
915482360 1:156195527-156195549 CGGCAGTACCGGGAGCCGAGTGG + Intronic
915815774 1:158963162-158963184 CTGCAGCAGCAGTGGCAGAGGGG - Intronic
916059208 1:161087282-161087304 CTGCTGCAGCAGCAGCAGAGTGG + Intronic
916568909 1:166008217-166008239 CTGCAGGGGCAGTGGCAGAGAGG + Intergenic
916758642 1:167797126-167797148 CTGCAGGACACTGAGCAGTGTGG - Intergenic
917208240 1:172601162-172601184 CAGCAGGAGCAGAAGCAGACAGG + Intronic
917838490 1:178959181-178959203 CTTCAGGCCAAGGAGCAGACTGG + Intergenic
920263298 1:204704139-204704161 CTGCGGGGCCTGGAGCAGAAAGG - Intergenic
922340056 1:224647838-224647860 CTGCAGGCACAGGGGCTGAGTGG + Intronic
922582696 1:226710580-226710602 GTGCTGGGCCAGGAGCAGAGAGG + Intronic
922695245 1:227728220-227728242 CTGCAGGTGCAGGAGCAATGAGG - Intergenic
922861339 1:228818883-228818905 CTGGATGGCCAGCAGCAGAGAGG + Intergenic
923235986 1:232033476-232033498 TGGGAGGACCTGGAGCAGAGGGG - Intronic
923334742 1:232958412-232958434 CTGAATGTCAAGGAGCAGAGAGG - Intronic
923391820 1:233519937-233519959 ATGCAGCACAAGAAGCAGAGAGG - Intergenic
923918765 1:238540667-238540689 AGGCAGTACCAGGAGCAGCGAGG - Intergenic
923980076 1:239311628-239311650 CTGCACTACCAGCAGCTGAGGGG + Intergenic
1065747221 10:28853518-28853540 CTTCAGGACCAGAAGCAGGGTGG + Intronic
1066571554 10:36778607-36778629 CTGCAGGGTCAGAAGCAGAATGG - Intergenic
1066715125 10:38278228-38278250 CTCCAGGTCCAGAAGCAGAGGGG + Intergenic
1067550056 10:47227740-47227762 CTGCAGGGAGGGGAGCAGAGGGG + Intergenic
1067767014 10:49094501-49094523 CTGAGGGACCTGGAGCAGGGTGG - Intronic
1068097612 10:52511645-52511667 CAGCAGCAGCAGGACCAGAGAGG + Intergenic
1069336779 10:67360703-67360725 TGGCAGGAGCAAGAGCAGAGAGG + Intronic
1069987726 10:72295766-72295788 CTGTAGTACAAGGTGCAGAGGGG + Intergenic
1070505102 10:77106190-77106212 CTGCAGGGTCAGGAACAGTGGGG + Intronic
1070684630 10:78471640-78471662 CTGGGGTCCCAGGAGCAGAGGGG - Intergenic
1070827105 10:79397702-79397724 CTGCAGAACCAGATCCAGAGTGG - Intronic
1071107284 10:82112970-82112992 CAGGAAGACCAGGAGCAGTGTGG - Intronic
1072454367 10:95562871-95562893 CTGCAGGATGAGGTGCAGATAGG - Intergenic
1074921390 10:118017549-118017571 CTGCAGGACACGGAGGAGACTGG + Intronic
1075539459 10:123299923-123299945 GGGCAAGACCAGGGGCAGAGAGG + Intergenic
1076372957 10:129966865-129966887 GGGCAGGAGCAGCAGCAGAGGGG + Intergenic
1076768917 10:132652355-132652377 CTGCAGCCCCAGGAGGAGCGGGG + Intronic
1076813205 10:132899667-132899689 CTGCAGGAACAGGGCCAGTGAGG + Intronic
1076883917 10:133252601-133252623 GGGCAGGGTCAGGAGCAGAGTGG - Intergenic
1076921284 10:133455953-133455975 CTGCAGACCCAGGAGGACAGGGG + Intergenic
1076945984 10:133650906-133650928 TCGCTGGATCAGGAGCAGAGCGG - Intergenic
1077112264 11:867008-867030 CTGGAGCACCAGGACCAGTGGGG - Exonic
1077177956 11:1199090-1199112 TTCGAGTACCAGGAGCAGAGCGG + Intronic
1077242808 11:1519573-1519595 ATGCAGGACACGGAACAGAGCGG + Intergenic
1077663777 11:4091259-4091281 CTGCAAGACATGGGGCAGAGAGG - Intronic
1077783214 11:5354667-5354689 CTGCAGGTCCAGGACCTGGGAGG - Intronic
1078524355 11:12089299-12089321 CTCAAGGACCACGAGAAGAGGGG + Intergenic
1078631441 11:13008174-13008196 GCGTAGGACCTGGAGCAGAGAGG + Intergenic
1078797841 11:14611088-14611110 CAGCAAGGCCAGTAGCAGAGTGG - Exonic
1078904381 11:15670857-15670879 CCGCCGGCCCAGGAGCAGAGAGG + Intergenic
1079243106 11:18734635-18734657 CTCCAGGAAGAAGAGCAGAGTGG - Intronic
1079321256 11:19453615-19453637 CTGCAGGTTCAGGAGCAGATGGG - Intronic
1079427125 11:20354253-20354275 CTTCAGGAGCAGGAGCTGAAGGG - Intergenic
1079472288 11:20789956-20789978 CAGAAGGACCAGCTGCAGAGAGG - Intronic
1080416103 11:32071229-32071251 GGGCAGGAACAGGAGCAGTGGGG - Intronic
1080689091 11:34540943-34540965 CTTCAGGGGCAGAAGCAGAGAGG - Intergenic
1081975999 11:47235206-47235228 CTGCAAGGCCAGGACCACAGAGG + Intronic
1081979929 11:47259888-47259910 CTGCAGTACCCCCAGCAGAGTGG - Exonic
1082776726 11:57250955-57250977 CTACAGGATAAGAAGCAGAGAGG + Intergenic
1082936118 11:58658628-58658650 CTGCAGGTGCAGGAGGAGAGAGG + Intronic
1083373726 11:62202952-62202974 CTCCAGGAGCATGAACAGAGAGG + Intergenic
1083484957 11:62977388-62977410 CTGCAGGGCCCGCAGCAGATGGG + Intronic
1083743953 11:64724949-64724971 CTGCAGGAAGAGGAACAGTGGGG - Intergenic
1083800141 11:65041752-65041774 CTGCAGGCCCAGGTGCAGGAGGG + Exonic
1084001389 11:66296953-66296975 CGGCATGCCCAGCAGCAGAGTGG - Intergenic
1085020045 11:73200873-73200895 CTGGAGGAAAAGGAGGAGAGAGG - Intergenic
1085022244 11:73217224-73217246 CACCAGGAGCAGTAGCAGAGTGG - Intergenic
1087172829 11:95067641-95067663 CTGCGGGACCTGGAGCAGCTGGG - Exonic
1088816876 11:113427374-113427396 CTGCAGGACCCTGAGGAGGGTGG - Intronic
1089546513 11:119231075-119231097 CTTGAGGAACAGGAACAGAGAGG - Intronic
1089580235 11:119477024-119477046 CAGCAGGAGCAGGAGCTCAGTGG + Intergenic
1090005694 11:123000439-123000461 CTTCATGACCAGGAGCTTAGGGG - Intergenic
1090553713 11:127851197-127851219 CTGCAACACCAGGAAAAGAGGGG - Intergenic
1090636982 11:128695277-128695299 AAGTAGGGCCAGGAGCAGAGAGG + Intronic
1091061103 11:132462957-132462979 TTGCAGCAGCAGGTGCAGAGTGG - Intronic
1091116174 11:133015812-133015834 CAGCAGGAGCAAGGGCAGAGTGG - Intronic
1091413648 12:261386-261408 CTGAAAGAGCAGGGGCAGAGTGG - Intronic
1091981346 12:4866622-4866644 CTGCCTGTCCAGGTGCAGAGTGG + Intergenic
1092066308 12:5592318-5592340 GTGCAGGTACAGGAGAAGAGGGG + Intronic
1092337738 12:7648617-7648639 CTGGATGACCAGATGCAGAGAGG - Intergenic
1094230014 12:28092263-28092285 CTCTACGACCAGGAGCTGAGTGG + Intergenic
1094388080 12:29917181-29917203 CTGCAGAACCAGAAGAAGAGTGG - Intergenic
1094473286 12:30822892-30822914 CTGCAGTGCCAGGAGCAGGCAGG + Intergenic
1095509102 12:42929865-42929887 CTTCAGTAACACGAGCAGAGTGG - Intergenic
1096188318 12:49598632-49598654 CTGCGGGACCAGGGGCAGAAGGG - Intronic
1096240023 12:49954820-49954842 CCCCAGGACCAGGAGGAGTGTGG - Intronic
1096980997 12:55728344-55728366 CTGCCGGGCCTGGGGCAGAGGGG + Exonic
1098128474 12:67323560-67323582 CTGCAGAAGCAGTGGCAGAGAGG - Intergenic
1098245203 12:68509922-68509944 CTGCAGGTGCAGGAGAAGAAGGG + Intergenic
1098465591 12:70783302-70783324 CTGCACAACCAGTAGCAGAGAGG - Intronic
1099292628 12:80790146-80790168 TTGCTGGATCAGGAGCACAGCGG - Intergenic
1100089494 12:90953682-90953704 CTGGAGGAGAACGAGCAGAGAGG - Exonic
1100105926 12:91171900-91171922 CTGTAGTAACAGGAGCATAGTGG + Intronic
1100831007 12:98516302-98516324 CTGCAGGCGCCGGAGCGGAGAGG + Intronic
1100847940 12:98679276-98679298 CAGGAGGACCAGCTGCAGAGAGG + Intronic
1102269126 12:111516193-111516215 CTGGAGAACCATGAGCAGAGGGG + Exonic
1102482722 12:113234715-113234737 CTGCCGGACCAGGGGCATACTGG + Intronic
1102490730 12:113288258-113288280 CTGCAGGTCCAGGTGCCGTGTGG + Intronic
1102719475 12:115003703-115003725 GTGGAGGCCCAGGAGGAGAGTGG - Intergenic
1102895031 12:116592100-116592122 CTCCAGCACCTGGATCAGAGGGG + Intergenic
1103920107 12:124394975-124394997 CTGGAGGATGAGCAGCAGAGGGG - Intronic
1103991787 12:124804270-124804292 CTGCAGGACTCGGAGCTGGGCGG + Intronic
1104008357 12:124911732-124911754 GCGCAGGACCAAGTGCAGAGTGG + Exonic
1104267703 12:127251929-127251951 CTGAAGGACAATAAGCAGAGAGG - Intergenic
1104364184 12:128162058-128162080 CTGAAGGCCCAGGAGCACTGAGG - Intergenic
1105068439 12:133219229-133219251 CTGCAGATCCAGGAGTAAAGAGG + Intronic
1105286868 13:19011736-19011758 CAGAAGGACCAGGAGCAGGCAGG + Intergenic
1105926266 13:25011563-25011585 CAGCAGGATCAGTATCAGAGAGG + Intergenic
1106019331 13:25899707-25899729 GTGCAGGAAGAAGAGCAGAGGGG + Intronic
1106038720 13:26069414-26069436 CAGCAGGATCAGAATCAGAGAGG - Intergenic
1106308965 13:28535894-28535916 CTGGAGGACCAGCAGCAGAGAGG + Intergenic
1106758988 13:32849422-32849444 AAGCGGGACCAGGAGAAGAGTGG + Intergenic
1106890924 13:34244538-34244560 CTGCAGGGGCATGGGCAGAGAGG - Intergenic
1107801838 13:44115766-44115788 CAGCTGGAGGAGGAGCAGAGAGG + Intergenic
1108615443 13:52128306-52128328 CTCCGGGACCAGGAGCAGCGTGG - Intronic
1108876215 13:55054094-55054116 TTGCTGGATCAGGAGCACAGCGG - Intergenic
1109470538 13:62799021-62799043 CTTGGGGACCAGGAGCAGGGAGG + Intergenic
1109931310 13:69222084-69222106 TTGCTGGATCAGGAGCACAGCGG - Intergenic
1109945005 13:69421143-69421165 CTGCAGGGCCAGCAGGAGACAGG - Intergenic
1110552144 13:76821987-76822009 AAGCAAGAGCAGGAGCAGAGAGG - Intergenic
1110987064 13:81984371-81984393 TTGCTGGATCAGGAGCACAGTGG + Intergenic
1112606603 13:100912531-100912553 CTTCAGAACCAGGAGCCTAGTGG - Intergenic
1113600093 13:111562495-111562517 CTTGAGGACCATGGGCAGAGGGG - Intergenic
1113885388 13:113656179-113656201 CTGCAGGGCCAGCACCAGGGAGG - Intronic
1114043584 14:18702283-18702305 CTGGAGGACCTGGATGAGAGCGG - Intergenic
1114114652 14:19508918-19508940 CTGGAGGACCTGGACGAGAGCGG + Intergenic
1114116349 14:19626681-19626703 CTGGAGGACCTGGACGAGAGCGG + Intergenic
1114350632 14:21846721-21846743 CTGCAGGACCCTGAGCAGGGAGG - Intergenic
1114354700 14:21894520-21894542 CTGGAGGGCCCTGAGCAGAGCGG - Intergenic
1114614402 14:24060614-24060636 CTGCAGCATCTGGAGCACAGTGG - Exonic
1114670318 14:24407690-24407712 GTGCAGGACCAGGGAGAGAGTGG + Intronic
1116024500 14:39498395-39498417 CTGAAGGTCCTTGAGCAGAGGGG + Intergenic
1116075739 14:40108487-40108509 CTGCAGGATAAGCAGCAGAGAGG - Intergenic
1116186344 14:41605502-41605524 CCGGAGTACCAGGGGCAGAGAGG + Intergenic
1116725265 14:48554767-48554789 CAGCAGCAGCAGCAGCAGAGTGG - Intergenic
1118755895 14:68843560-68843582 CTGCAGGACGGGGGGCGGAGGGG - Intergenic
1119485061 14:74981598-74981620 CTGGAGGGCCACGTGCAGAGGGG - Intergenic
1119698169 14:76730660-76730682 CAGCAGGAGCAGGAGCCGAAAGG + Intergenic
1119936185 14:78594257-78594279 CTGAAGGACAAGGCGCCGAGGGG + Intronic
1120058085 14:79948892-79948914 CTGCAGGACCGAGCGCAGTGGGG - Intergenic
1121109716 14:91303812-91303834 CTGCAGGACCACGAGCACCTGGG - Exonic
1121262631 14:92577515-92577537 CGGCAGCAGCAGCAGCAGAGAGG + Intronic
1121695321 14:95907866-95907888 CAGGAGGACCAGCTGCAGAGAGG - Intergenic
1121708220 14:96017164-96017186 ATGCTGGAGGAGGAGCAGAGTGG - Intergenic
1121712296 14:96047795-96047817 GTGCATGAACAGGGGCAGAGGGG - Intronic
1122147147 14:99698225-99698247 CTGCAGGACCCAGAGCCCAGAGG - Intronic
1122418023 14:101559702-101559724 CTGCAGGACCAGGGCCCCAGCGG - Intergenic
1122627770 14:103092912-103092934 CTGCAGCACCATCTGCAGAGGGG - Intergenic
1122839081 14:104446026-104446048 TTGCAGAACCAGGAGCACGGAGG - Intergenic
1122883777 14:104701561-104701583 GTGCAGTTCCTGGAGCAGAGCGG + Exonic
1124170534 15:27368638-27368660 CTGCAGGACACTGAGCACAGGGG + Intronic
1124179028 15:27456086-27456108 CTGCAGGACCAGAAGCAGTGCGG - Intronic
1125035632 15:35121196-35121218 CTGCAGACCGAGGAACAGAGGGG - Intergenic
1125381562 15:39092258-39092280 CGGGAGGACCAGCTGCAGAGAGG - Intergenic
1125472335 15:40016405-40016427 CTGCAGGAGCAGGAGCACATGGG - Intronic
1125681086 15:41530578-41530600 ATGCCAGACCAGAAGCAGAGAGG - Intronic
1126518139 15:49558072-49558094 CTGCCGGATGAGGAGCAGTGGGG - Intronic
1126929042 15:53626392-53626414 TTGCTGGATCAGGAGCACAGCGG + Intronic
1127186626 15:56487115-56487137 CTGAGAGACCAAGAGCAGAGGGG - Intergenic
1127918724 15:63476524-63476546 CTGGAAGACCAGGAGCAGGGAGG + Intergenic
1127964801 15:63915602-63915624 CTGCTGGGCCAGGAGGAGGGTGG - Intronic
1128363097 15:66976411-66976433 TTGCTGGATCAGGAGCACAGCGG + Intergenic
1128496126 15:68199639-68199661 CTGTATGACAAGCAGCAGAGGGG - Exonic
1129172319 15:73815792-73815814 CTGGAGGAGCAGGGGCAGAAAGG - Intergenic
1129372488 15:75106245-75106267 CTGCAGCAGCAAGAGCAGAATGG + Intronic
1129667617 15:77588288-77588310 CAGAAGGACCAGGAGGACAGAGG + Intergenic
1129850532 15:78791152-78791174 CAGCAGGACCAGGCGCACAATGG + Exonic
1130004817 15:80085063-80085085 CTTGAGGACCAGGAGGAAAGTGG - Intronic
1130251735 15:82304370-82304392 CAGAAGGACCAGGAGCACAATGG - Intergenic
1130535638 15:84783318-84783340 CAGCAGGAACACGAGCAAAGTGG + Exonic
1130825960 15:87546621-87546643 TTGCTGGATCAGGAGCACAGTGG + Intergenic
1130881753 15:88061526-88061548 GAGCAGGAGCAGGAGCAGAGTGG + Intronic
1130963508 15:88680809-88680831 TTGCAGGTCCAGATGCAGAGTGG + Intergenic
1131192005 15:90324389-90324411 CTGCAGGAGCAGTTACAGAGCGG - Intergenic
1131958674 15:97765319-97765341 CTTCAGGACCAGGAACTTAGTGG + Intergenic
1132426967 15:101725585-101725607 GTGCAGGAGAAGGAGCGGAGGGG + Intergenic
1132659263 16:1054274-1054296 GGGCAGGACCAGGAGGAGCGGGG - Intergenic
1132925259 16:2425953-2425975 CTGCAGTGCACGGAGCAGAGTGG + Intergenic
1133638519 16:7694576-7694598 TTGCAGGACCATCAGCAAAGAGG - Intronic
1133994739 16:10739911-10739933 TTGCAGGACCAGGAGGAGGAGGG + Intergenic
1135284636 16:21182801-21182823 ATGGAGGCCCAAGAGCAGAGAGG + Intergenic
1136231626 16:28888947-28888969 CTGCAAGGTCAGGAGCAGTGTGG + Exonic
1136399644 16:30010544-30010566 AGGCAGGCTCAGGAGCAGAGGGG - Intronic
1137456630 16:48622835-48622857 GCGCAGCACCAGGAGCGGAGGGG - Intergenic
1137587301 16:49671285-49671307 CTGCAAGAACAAGATCAGAGGGG - Intronic
1137698406 16:50478359-50478381 CTGGACGACCAGCTGCAGAGAGG - Intergenic
1138536428 16:57662815-57662837 CTGCACGGCCAGGAACAGAGGGG - Intronic
1139314538 16:66057009-66057031 CTGGAGGTCCAAGATCAGAGTGG - Intergenic
1139360781 16:66398445-66398467 CTGCAGGACCAGCTGGAGTGTGG - Exonic
1139778810 16:69334161-69334183 CTGTAAGACCCTGAGCAGAGAGG + Intronic
1139997038 16:70991237-70991259 AGGCAGAATCAGGAGCAGAGTGG - Intronic
1140344639 16:74201102-74201124 CTGCAGGACCAGGAGCCGAAGGG - Intergenic
1141099268 16:81185186-81185208 CAGCTGGAGCAGGAACAGAGCGG - Intergenic
1141438540 16:84014619-84014641 GGGCAGAGCCAGGAGCAGAGTGG + Intronic
1141579671 16:84988598-84988620 CCGCAGGAGCAGGAGCGGGGTGG + Intronic
1141858319 16:86700153-86700175 CTGCAGGACCTCAAACAGAGAGG + Intergenic
1141894208 16:86948170-86948192 GAGCAGGAGCAGGAGCAGAGTGG - Intergenic
1141982630 16:87559922-87559944 CTACAGGACCATGAACAGAGGGG - Intergenic
1142246084 16:88970691-88970713 CTGAAGGACCAGGAGCACGGAGG + Intronic
1142608153 17:1093508-1093530 CTGCAGACCCAGGAACAGTGGGG + Intronic
1143029463 17:3959819-3959841 CTGCAGGCCCCGCTGCAGAGCGG - Intronic
1143632711 17:8148037-8148059 ATGCAGGAACAGGAGCACTGGGG + Exonic
1144021979 17:11245706-11245728 CTGCCTGCACAGGAGCAGAGGGG + Intronic
1144570006 17:16391597-16391619 CTGCAGGTCCTGCAGAAGAGCGG - Intergenic
1144872866 17:18381397-18381419 CTGCAGCACCAGCAGGAGACGGG + Exonic
1145018332 17:19412918-19412940 CTCCTGGGCCAGGAGAAGAGAGG - Exonic
1146006667 17:29164822-29164844 CAGGAGGCACAGGAGCAGAGAGG - Intronic
1146399945 17:32494394-32494416 CTGCAGGGTCAGCAGCAGGGAGG + Exonic
1146533507 17:33630339-33630361 CTGCACAGACAGGAGCAGAGGGG - Intronic
1147187737 17:38721969-38721991 AGGCAGGGCCAGGGGCAGAGTGG - Exonic
1147333831 17:39715241-39715263 CAGCAGGGCCAGGAACAGGGTGG - Intronic
1148241536 17:46002422-46002444 CTGCAGGATCAGGAGAACTGGGG + Intronic
1148736708 17:49869261-49869283 CTCCAGGCCCAGGAGCCCAGAGG - Intergenic
1148769605 17:50059274-50059296 GTGCAGGTGCTGGAGCAGAGAGG - Intronic
1148793612 17:50186976-50186998 CTGGAGGGCCATGAGCAGAGGGG + Intronic
1148827580 17:50405232-50405254 TTGCTGGATCAGGAGCACAGCGG + Intergenic
1149274547 17:55018286-55018308 TTGCTGGATCAGGAGCACAGCGG + Intronic
1149992064 17:61388823-61388845 CTGCAGGGGGAGGAGCAGAAGGG + Intronic
1150163994 17:62924117-62924139 CCACAGGAGCAGAAGCAGAGGGG - Intergenic
1150285393 17:63951073-63951095 CTCCAGGACCAGGACCTGAGAGG - Intronic
1151530802 17:74703483-74703505 CAGCAAAAACAGGAGCAGAGTGG + Intronic
1151748382 17:76023602-76023624 CTGCAGCACCAGCAGGAGACGGG - Exonic
1152092120 17:78252814-78252836 CTTCAGGAGCAGAAGCAGACTGG - Intergenic
1152248056 17:79196176-79196198 CTGGAGAAACAGCAGCAGAGTGG + Intronic
1152544955 17:80995767-80995789 CTGCAGGGCCAGGGGCATGGAGG + Intronic
1155108527 18:22690697-22690719 CTGGAGGGCTTGGAGCAGAGGGG - Intergenic
1155240390 18:23858895-23858917 CTGCAGGCCAAGGAGCAGCGAGG - Intronic
1155329317 18:24698760-24698782 CTGCAAGCCAAGGAGGAGAGAGG + Intergenic
1155708603 18:28847529-28847551 CTGCAGCAGCAGTGGCAGAGGGG - Intergenic
1156482530 18:37445229-37445251 CTGCAGAAGCGGGAGCAGAGGGG + Intronic
1157043633 18:44068827-44068849 CTGGAGGACCTGGAGGAGATGGG - Intergenic
1157530583 18:48417241-48417263 CTGCAGCGTCAGGAGCAGATGGG - Intergenic
1157608685 18:48942299-48942321 CTGCAGGATGAGGAGCTGAAGGG + Intronic
1158658657 18:59364661-59364683 CAGAAGGACAAGGAGCAGATTGG - Intergenic
1159028476 18:63208021-63208043 TGGTAGGACCAGGAGCAGATGGG - Intronic
1159832240 18:73291257-73291279 CTGAAGGACCAGTGGAAGAGTGG + Intergenic
1160007102 18:75075602-75075624 CAGCATGTCCAGGAGCAGAGGGG - Intergenic
1160292859 18:77609654-77609676 CTGGATGACCAGCTGCAGAGAGG + Intergenic
1160365257 18:78319225-78319247 CTGCAGAAGCAGGAGAAGAGAGG - Intergenic
1160591229 18:79945683-79945705 CTGCAGGAGCAGGAGTGCAGGGG + Intronic
1160592172 18:79951106-79951128 CCGCAGGACCCGAGGCAGAGCGG + Intronic
1160708957 19:541973-541995 CTCCAGGACCTGGAGCTGACAGG - Exonic
1161151459 19:2712278-2712300 CGGCCGGAGCAGGAGCACAGGGG - Intergenic
1161327418 19:3670457-3670479 CGGAGGCACCAGGAGCAGAGGGG + Intronic
1161720387 19:5899012-5899034 CTGCTGGGCCAGGAGCAGGTGGG - Intronic
1161769306 19:6222685-6222707 CTGCAAGGCCAAGAGCAGGGAGG + Intronic
1161793923 19:6375799-6375821 CTGCAGGGACAGGAGCAGCAGGG + Exonic
1161953838 19:7482212-7482234 CTGCAGGACCAGGAGCAGAGGGG + Intronic
1162230612 19:9262836-9262858 CTGCATGTCCAGGAGCAGTATGG - Intergenic
1162419773 19:10559530-10559552 CTGCAGGCCCAGGCAGAGAGGGG + Intronic
1162662637 19:12182345-12182367 CCCCAGGACCAGGAAAAGAGAGG - Intronic
1163442956 19:17330745-17330767 CTGCAGGAGCAAAGGCAGAGAGG - Intronic
1163466253 19:17470051-17470073 AGGCAGGACCAGGAGGAAAGGGG + Intronic
1163784274 19:19266610-19266632 CTGCAGGGGCGGGAGGAGAGGGG + Intronic
1164056883 19:21629546-21629568 TTGCTGGATCAGGAGCACAGTGG - Intergenic
1164235035 19:23324216-23324238 CAACAGGACCAGGAGAGGAGAGG - Intronic
1164250310 19:23469834-23469856 CAACAGGACCAGGAGAGGAGAGG - Intergenic
1166748309 19:45152395-45152417 CTGGAGGACCGGCAGCAGACCGG - Exonic
1166852345 19:45766792-45766814 CTGAGGGTCCAGGACCAGAGAGG + Exonic
1166944739 19:46390028-46390050 CTGCAGGGACAGGAGCAGAGTGG - Intronic
1167148316 19:47695255-47695277 CCGGAGGGCCAGGAGGAGAGCGG + Intronic
1167436226 19:49480367-49480389 CAGCAGTAGGAGGAGCAGAGGGG - Exonic
1167679890 19:50912689-50912711 GTGGGGGGCCAGGAGCAGAGGGG + Intergenic
1167711068 19:51111356-51111378 CTGTGGGACCAGGATAAGAGTGG + Intergenic
1167757613 19:51422155-51422177 CTGCAGGACCATGGACAGCGCGG - Intergenic
1168245988 19:55113437-55113459 CTGCAGGGCCCCGTGCAGAGGGG - Intronic
925071321 2:969929-969951 CTGGAGAACCAGAAGCAGACAGG - Intronic
925148325 2:1598158-1598180 CTGCAGGACGGCGTGCAGAGGGG + Intergenic
925267201 2:2574470-2574492 CAGCAGGACCAGGAGCTGTCGGG + Intergenic
925327296 2:3033279-3033301 CAGCAGCACCCGGAGGAGAGGGG + Intergenic
925367479 2:3320402-3320424 ATGCAGGACCTGGAGCACACAGG - Intronic
926160714 2:10487543-10487565 CTCCAGGAACAGGCGCAGAGAGG - Intergenic
926953637 2:18271394-18271416 CGGGAGGACCAGTTGCAGAGAGG - Intronic
927875111 2:26650099-26650121 CTGCAGAATGAGCAGCAGAGAGG + Intergenic
928319133 2:30269333-30269355 TTGCTGGATCAGGAGCACAGCGG - Intronic
931252079 2:60541062-60541084 CTTCAAGAACAGGAGCAGAGGGG - Intronic
931867162 2:66425849-66425871 CTGCAGAACCGGGGACAGAGCGG - Intergenic
932279499 2:70477722-70477744 CTGCAGGACATGGAGGAGGGAGG + Intronic
932486004 2:72084765-72084787 CTGCCGCACCAGGAGCAGCAAGG + Intergenic
932558524 2:72846832-72846854 CTGGTGTAGCAGGAGCAGAGAGG + Intergenic
932586913 2:73036241-73036263 CTGCAGACACAGGAGCAGAGGGG - Intronic
934033422 2:88067685-88067707 CTCCAGGAAAAGTAGCAGAGGGG + Intergenic
934567852 2:95350511-95350533 CAGCAGGAGGTGGAGCAGAGGGG - Intronic
934623213 2:95829035-95829057 CTGCAGAAGCAGTGGCAGAGAGG + Intergenic
934708669 2:96501790-96501812 GAGCAGGACCAGGAGGGGAGGGG - Intronic
934810553 2:97273058-97273080 CTGCAGAAGCAGTGGCAGAGAGG - Intergenic
934827139 2:97434881-97434903 CTGCAGAAGCAGTGGCAGAGAGG + Intergenic
935193156 2:100794273-100794295 CTGCTGGAAGAGGAGCTGAGAGG + Intergenic
935603428 2:104946081-104946103 CTACAGGACCAGGAGAAATGCGG + Intergenic
936270780 2:111046925-111046947 CAGCAGGGCCAGGCTCAGAGTGG + Intronic
937163356 2:119787585-119787607 CTGTAGTACCTGGAACAGAGTGG + Intronic
937379637 2:121365112-121365134 CTCCAGCAGCAGGAGCAGAATGG + Exonic
937380311 2:121370725-121370747 CTGCAGGGCCAGGAGGAGTCAGG - Intronic
937389642 2:121473524-121473546 CTGCAGGACGAGGGGAAGAAGGG + Intronic
937443807 2:121939430-121939452 CTGCAGGGCCTGGAGCAGGAGGG - Intergenic
938065584 2:128280374-128280396 CTGCAGGTCCAGGAGGGCAGGGG + Intronic
938163625 2:129008190-129008212 CAGCAGGAGCAGGAGCATGGTGG - Intergenic
938425243 2:131181248-131181270 CTGGAGGACCTGGACGAGAGCGG - Intronic
938770145 2:134494820-134494842 CTGGGGGACCCGGAGCATAGGGG - Intronic
939004523 2:136770523-136770545 CTGTAGGACCAGGATGATAGTGG - Intronic
940857090 2:158737965-158737987 CTGCAGGTCCTGCAGCAGGGAGG - Intergenic
942498699 2:176565641-176565663 ATAGAGTACCAGGAGCAGAGGGG - Intergenic
942585404 2:177470228-177470250 CAGCAGGTCTAGGAGCAGAATGG + Intronic
944224853 2:197339480-197339502 TTGCAGGACAGAGAGCAGAGAGG + Intergenic
944471301 2:200055930-200055952 CTGCAGCAGCAGTGGCAGAGGGG - Intergenic
944529096 2:200649999-200650021 CTGCTGGGGCATGAGCAGAGAGG - Intronic
944689556 2:202147347-202147369 CTGAAGGTCTAGGGGCAGAGGGG + Intronic
945019572 2:205557440-205557462 CTGCAGGAGCAGAAGTTGAGGGG - Intronic
945166922 2:206956166-206956188 GTGCAGAACCAGGAGCTCAGGGG - Intronic
945168328 2:206969390-206969412 CAGCAGGCCCAGCAGCATAGTGG - Exonic
945357425 2:208856762-208856784 CTGCAGCAGCAGTAGCAGAGGGG + Intergenic
945552552 2:211238136-211238158 CTGCAGAGCCAGAAGCACAGAGG + Intergenic
946197404 2:218043323-218043345 CTGGATGACCAGCTGCAGAGAGG - Intronic
946522868 2:220485730-220485752 CTGCAGGACAGGCAGCAAAGAGG + Intergenic
947585895 2:231356626-231356648 TTCCAGGCCCAGGTGCAGAGCGG + Intronic
948786025 2:240353390-240353412 CTGGCAGACCACGAGCAGAGTGG + Intergenic
948929185 2:241119803-241119825 CAGCAGGATAAGGAACAGAGTGG - Intronic
949043094 2:241858446-241858468 CTGCCTGCCCAGGAGCAAAGAGG + Intronic
1168788090 20:557106-557128 CTGCTGGGCCAGGAGCAGGGAGG + Intergenic
1168891405 20:1297266-1297288 CAGCAGGGCCAGGCCCAGAGAGG - Intronic
1169200211 20:3705613-3705635 CTGGAGGCCCAGGAGCAGCCTGG + Intronic
1169931295 20:10835933-10835955 GTGCAGGACTTGGAGCATAGTGG - Intergenic
1170316173 20:15043549-15043571 CTGAAGGCCCAGGAGTACAGGGG - Intronic
1170331710 20:15219365-15219387 CAGCAGGAGTAGGAGCAGGGTGG - Intronic
1170791214 20:19511054-19511076 CTGCAGGGTCAGCAGCAGGGTGG - Intronic
1171265529 20:23769052-23769074 CTGCAGCATCATGAACAGAGAGG + Intergenic
1171386350 20:24771787-24771809 CTCCAAGCCCAGGAGCAGAGGGG + Intergenic
1171878932 20:30602545-30602567 CTCCAGGAGCATGAGCTGAGTGG + Intergenic
1172873026 20:38147505-38147527 CTGCAGGGCCAGGCTCAGGGAGG - Intronic
1172945934 20:38689217-38689239 CTACAAGAACAGGAGCAGTGTGG + Intergenic
1173179746 20:40796825-40796847 GGGCAGGAGCAGCAGCAGAGTGG - Intergenic
1173347597 20:42215210-42215232 CTGCAACACCAAGAACAGAGGGG - Intronic
1173609356 20:44355527-44355549 GTGCAGGACTAGGACCCGAGTGG + Intergenic
1174065907 20:47866032-47866054 CAGCATGACCAGATGCAGAGAGG + Intergenic
1174180314 20:48670295-48670317 CAGCAGGGGCAGGGGCAGAGAGG - Intronic
1174401368 20:50277829-50277851 TTACAGGCCCTGGAGCAGAGAGG - Intergenic
1174488035 20:50873391-50873413 CCTCAGGACCAGGAGAAGAAGGG + Intronic
1174819323 20:53713478-53713500 TGGCAGGATCAGGTGCAGAGGGG - Intergenic
1175138263 20:56841127-56841149 CTACAGGAACAGGCACAGAGCGG + Intergenic
1175478621 20:59295443-59295465 CTCCAGAACCAGCAGCAGAATGG - Intergenic
1175715950 20:61253920-61253942 CTGAAGGAGCAGGAGCACAGCGG - Intronic
1175741846 20:61425257-61425279 CTCCGGGAACAGGAGCAGGGAGG + Intronic
1176299071 21:5090149-5090171 CTGCACGTACCGGAGCAGAGCGG + Intergenic
1178586497 21:33875265-33875287 CTGCAGGACCAGGCCCAGCGGGG - Intronic
1178767891 21:35471534-35471556 CTGCAGGACCAGGAGTGCAGGGG - Intronic
1179085106 21:38209182-38209204 CTGGAGCAGCAGGAGCAAAGGGG + Intronic
1179459184 21:41522237-41522259 CTGATAGCCCAGGAGCAGAGTGG + Intronic
1179857954 21:44171799-44171821 CTGCACGTACCGGAGCAGAGCGG - Intergenic
1180089692 21:45527559-45527581 CTGCAGGCCCTGGAGGTGAGTGG + Intronic
1180466404 22:15615401-15615423 CTGGAGGACCTGGATGAGAGCGG - Intergenic
1181409527 22:22709226-22709248 ATGAAGAACCAGGAGCAAAGAGG + Intergenic
1182212662 22:28689782-28689804 CTGCAGGAGCGGGAGGTGAGGGG + Intronic
1182221372 22:28761617-28761639 CTGCTGTATCAGGAGCACAGAGG - Intergenic
1182318245 22:29462138-29462160 CTGCAGACCCAGGTGCAGAGTGG + Intergenic
1182556989 22:31134485-31134507 CTGGAGGAGCAGCAGGAGAGAGG - Exonic
1182746126 22:32606765-32606787 CTGAATGAAGAGGAGCAGAGAGG - Intronic
1182894658 22:33849227-33849249 CTGCTGGACCTGGAGTTGAGGGG - Intronic
1183621013 22:38972640-38972662 CTGCGAGACCAGGTGGAGAGAGG - Intronic
1183831828 22:40422253-40422275 CAGCTGGGCCAGGAGCACAGTGG + Intronic
1184173893 22:42775139-42775161 CTGGATGACCAGCTGCAGAGAGG + Intergenic
1184404622 22:44292881-44292903 CTGCAGGAGCAGGAGCCATGAGG - Intronic
1184764531 22:46564569-46564591 CTGGAGGATCCTGAGCAGAGAGG + Intergenic
1184869023 22:47221879-47221901 CTGCACGCCCAGGAGCATGGAGG + Intergenic
1184887657 22:47356249-47356271 CTGCAGGTCCAGGAGCCATGGGG - Intergenic
1184893260 22:47392146-47392168 CTGCAGGGCAGGGAGGAGAGAGG - Intergenic
1185236462 22:49716420-49716442 TTGCAGCACCAGCAGCAGCGAGG - Intergenic
950138665 3:10600667-10600689 CTGCCGGGCCAGGGGCAGGGAGG - Intronic
950293625 3:11808459-11808481 GTGCAGGCCCAGGAGGAGAGTGG + Intronic
950577095 3:13838493-13838515 TTGAAGGACCAGGCTCAGAGAGG - Intronic
950637458 3:14324828-14324850 CTTCACGCCCAGCAGCAGAGTGG - Intergenic
951326061 3:21303062-21303084 TTGCTGGATCAGGAGCACAGTGG + Intergenic
951837656 3:27001208-27001230 GTGCTGGATCAGGAGCACAGCGG - Intergenic
953579053 3:44136916-44136938 CTCCAGAACAAGGAGCAGAGTGG + Intergenic
953854543 3:46491087-46491109 CAGAAGGACCAGGAGCAGCGAGG + Intergenic
954266002 3:49470605-49470627 CTGCGGGACCCAGAGCAAAGGGG - Intronic
955225980 3:57060712-57060734 CTGCAGGATCAGGAAGAGTGGGG - Exonic
955601045 3:60645316-60645338 CTGGAAGGCCAGGAGAAGAGGGG - Intronic
955776991 3:62444146-62444168 CTGTAGGATCCAGAGCAGAGGGG - Intronic
956462275 3:69484690-69484712 CTGGACAACCAGCAGCAGAGAGG - Intronic
957210392 3:77251052-77251074 CTGCAGTTCCAGGAGCTCAGGGG + Intronic
957296899 3:78344198-78344220 TTGCTGGATCAGGAGCACAGTGG + Intergenic
957440623 3:80242146-80242168 GTGCAGGACAAAGGGCAGAGAGG + Intergenic
958636264 3:96750642-96750664 CAGGAGGACCAGCTGCAGAGAGG + Intergenic
959450004 3:106487133-106487155 TTGCTGGATCAGGAGCACAGCGG + Intergenic
960155971 3:114297549-114297571 CGGCAGGACCGGGAACAGGGAGG + Intronic
960634213 3:119767972-119767994 CTGAATGACCAGTTGCAGAGAGG - Intergenic
961493058 3:127268767-127268789 CTGCAGGAACAGCAGCACTGTGG + Intergenic
961814829 3:129544101-129544123 CTGCATGACCGGGAGGAGAGAGG + Intronic
962210412 3:133472543-133472565 CTGCTGGACAGGGAGGAGAGCGG + Exonic
962252035 3:133841403-133841425 GGGCAGGACCATGGGCAGAGGGG + Intronic
965113065 3:164451698-164451720 CTACAGGAACAGTGGCAGAGGGG + Intergenic
966806243 3:183810018-183810040 CTCCAGGACAGGGAGCACAGAGG - Intronic
967389147 3:188938513-188938535 TTGCTGGATCAGGAGCACAGCGG + Intergenic
968943840 4:3653419-3653441 CTTCAGGACCGCAAGCAGAGTGG - Intergenic
970155256 4:13134840-13134862 CTGGAGTACCAGAAGCAGATGGG + Intergenic
970487734 4:16541444-16541466 CTGCAGAACCATGAGCTGATTGG + Intronic
970993384 4:22238146-22238168 CAGCAGGACCCGGAGCTGGGAGG + Intergenic
972297200 4:37751351-37751373 ATTCAGGACCAGAAGCAGAGAGG - Intergenic
975083301 4:70306519-70306541 CTGCTGGACCAGGATGGGAGTGG + Intergenic
975844813 4:78513993-78514015 CTCCAGAAGCAGGAGCTGAGAGG + Intronic
975936632 4:79589202-79589224 CTGCAGTCCCAGGCGCACAGTGG + Intergenic
976390716 4:84501323-84501345 CTGGAGGGCCAGGCGCAGAGTGG - Intergenic
978905292 4:113998053-113998075 CTGCAGAATCATGAACAGAGAGG - Intergenic
979649463 4:123113993-123114015 CAGGATGACCAGCAGCAGAGAGG - Intronic
979993314 4:127401827-127401849 CCTGAGGACCAGGAGCATAGGGG - Intergenic
980158516 4:129133765-129133787 GCCCAGGACCAGGAGCAGTGTGG - Intergenic
980387443 4:132104586-132104608 GAGCAGGAGCAGGAGCACAGTGG - Intergenic
982392279 4:154877615-154877637 CTGCAGAACCAGCTGCTGAGAGG + Intergenic
982418439 4:155164778-155164800 CTGCATTTCCAGGAGCAGAATGG + Intergenic
983075862 4:163325898-163325920 CTGCAGCACCAAGAGGAGAGTGG + Exonic
985449393 4:190051559-190051581 TCGCTGGATCAGGAGCAGAGCGG - Intergenic
985607910 5:868535-868557 CTCCAACAACAGGAGCAGAGTGG + Intronic
985705305 5:1397117-1397139 CTGGAGGACCTGGGGCAAAGTGG + Intronic
986195843 5:5535824-5535846 CTGCAGCTCCAGGTGCAGATGGG + Intergenic
986576548 5:9219301-9219323 CTGCAGGACCTGGGGTTGAGTGG + Intronic
986668701 5:10125232-10125254 CTGCAGGCCAAGGAACACAGAGG + Intergenic
986778683 5:11044715-11044737 ATACAGATCCAGGAGCAGAGTGG + Intronic
986893850 5:12341541-12341563 CTGCAGGACTACAAGCAGAGAGG - Intergenic
988093185 5:26569010-26569032 CAGGAGGACCAGCTGCAGAGAGG - Intergenic
989204386 5:38796980-38797002 CTGCAGAACCAGAAGTAGGGTGG - Intergenic
989461818 5:41708498-41708520 CTGCAGCAACAGTGGCAGAGAGG - Intergenic
992016000 5:72575855-72575877 CTGCAAGACAGCGAGCAGAGTGG + Intergenic
992459088 5:76943597-76943619 TCCCAGGACCAAGAGCAGAGAGG - Intergenic
994473414 5:100238433-100238455 CTGCAGAAGCAGTAGCAGAGAGG + Intergenic
994678182 5:102851021-102851043 CTGCTGGAACAGGAGGAAAGAGG + Intronic
994871233 5:105352077-105352099 TTATAGGAACAGGAGCAGAGTGG + Intergenic
994998318 5:107094329-107094351 CTGCAGGACCACTTGCAAAGGGG + Intergenic
995744932 5:115393464-115393486 CAGCACAACCAGTAGCAGAGAGG - Intergenic
996234419 5:121108591-121108613 CCGGCGGACCAGCAGCAGAGAGG - Intergenic
996514687 5:124356844-124356866 GTCCAGGACAAGGAGAAGAGGGG + Intergenic
996893992 5:128457327-128457349 CTGGAGTACCAGGAGGAGACAGG + Intronic
997659513 5:135578740-135578762 CAGCAGCAGCAGGAGCAGCGCGG + Exonic
997829122 5:137133928-137133950 CTCTAGGGCCAGGAGCAGATGGG + Intronic
998119114 5:139561608-139561630 CGGCAGGCCCAGGAGCTGAGTGG + Exonic
998665974 5:144298007-144298029 TTGCTGGATCAGGAGCACAGCGG - Intronic
999052172 5:148534544-148534566 CTGCAGAAGCAGTGGCAGAGAGG - Intronic
999272283 5:150303415-150303437 CTGCAGAACGAGGAGGAGGGAGG - Intronic
999505682 5:152193449-152193471 CTGCAGGATCCAGAGCAGACAGG - Intergenic
1000586092 5:163100744-163100766 AGGCACAACCAGGAGCAGAGGGG - Intergenic
1000698796 5:164422215-164422237 CTGCAGCAGCAGGGGCACAGGGG + Intergenic
1001746506 5:174096640-174096662 CTGGAGGCCCAGGAGCAGTGAGG + Intronic
1002170048 5:177369868-177369890 CTGCAGGAGCAGGTGGAGTGTGG - Intronic
1002338222 5:178495061-178495083 CTGCAGGCCCAGGAGGAGGCTGG - Intronic
1002636465 5:180611298-180611320 CTGCAGGTCCAGGAGTAGGGTGG - Intronic
1003115099 6:3278343-3278365 CTTCAGGCCCAGAAGCACAGTGG - Intronic
1004302234 6:14469082-14469104 TTGCAGGACCAGCAGAACAGAGG - Intergenic
1004520875 6:16359432-16359454 CTGGATGACCAGTTGCAGAGAGG + Intronic
1006154233 6:32005687-32005709 CAGCAGGCCCAGGAGCAGCATGG - Intergenic
1006160537 6:32038421-32038443 CAGCAGGCCCAGGAGCAGCATGG - Exonic
1006285977 6:33094656-33094678 AAGCAGGCTCAGGAGCAGAGAGG + Intergenic
1006291522 6:33141417-33141439 AAGCAGGCTCAGGAGCAGAGAGG + Intergenic
1006421256 6:33935540-33935562 CTGCAGGGGCGGGAGCAGAGGGG + Intergenic
1006788679 6:36684616-36684638 ATGCTGGACCAGGACCAGACAGG - Intronic
1006919015 6:37615411-37615433 CTGGAGGCCAAGGAGCAGACAGG + Intergenic
1007412665 6:41673950-41673972 CTGCAGAGCCAGGAGAAGGGAGG + Intergenic
1007553175 6:42745789-42745811 CTGCAGCCCCTGGAGCCGAGAGG + Exonic
1008549090 6:52610500-52610522 CTGCAGGACAAGGAGAAAGGTGG - Intergenic
1009621556 6:66084647-66084669 CAGCAGGAGCAGCAGCACAGTGG + Intergenic
1010023375 6:71187634-71187656 CTACAGGGTCTGGAGCAGAGTGG - Intergenic
1010360431 6:74987060-74987082 CTGCAGGAGCTGGAGCAGCCGGG - Intergenic
1010893028 6:81337401-81337423 TTGCTGGATCAGGAGCACAGCGG - Intergenic
1011215221 6:84998325-84998347 CTGCAGGGCTTTGAGCAGAGAGG + Intergenic
1012956970 6:105581660-105581682 CTGCAGGTCCAGGAGTAGTGTGG - Intergenic
1014289302 6:119539843-119539865 CAGGAGGACCAGTGGCAGAGAGG + Intergenic
1014336703 6:120146830-120146852 CTGCAGGAGCAGGAGCAGGAGGG - Intergenic
1015720864 6:136240030-136240052 GTGTAGGTCCAAGAGCAGAGCGG + Intronic
1017740959 6:157406225-157406247 CTGGAGGACCGGGTGCTGAGAGG + Intronic
1017960797 6:159218843-159218865 CTGCAGGACAGGGAGCTGAGAGG + Intronic
1018435167 6:163752673-163752695 CAGCAGGAGCAAGGGCAGAGAGG + Intergenic
1019337624 7:492789-492811 GTGCAGGACCCGGAGCAGTTGGG + Intergenic
1019660186 7:2219775-2219797 CTGGAGCACCAGGAGGAGGGTGG - Intronic
1019705074 7:2493756-2493778 CTGCAGGATGAGGCCCAGAGAGG - Intergenic
1019716056 7:2539880-2539902 CTTCAGAACCTGGAGCAGATAGG + Exonic
1019728478 7:2616632-2616654 GTTCAGACCCAGGAGCAGAGAGG + Intergenic
1020006312 7:4785308-4785330 AGGCAGGACCGGGAGCAGGGGGG - Intronic
1020260776 7:6529676-6529698 CAGCAGAGCCAGGAGCAGTGGGG + Intronic
1021050669 7:15980821-15980843 TTTCATGACAAGGAGCAGAGAGG + Intergenic
1022111348 7:27234304-27234326 CTGCAGGAGCTGGAGGAGGGTGG - Intergenic
1022370283 7:29764803-29764825 CTGCAGGGTTAGGAGGAGAGTGG - Intergenic
1022459864 7:30594962-30594984 CGGCAGCAGCAGCAGCAGAGCGG - Exonic
1022499689 7:30874710-30874732 CAGCAAGAACAGAAGCAGAGAGG - Intronic
1023829247 7:44029415-44029437 CTGCAGCACCCGGAGCAGCCGGG + Intergenic
1023989295 7:45118624-45118646 CTTCAGGGCCTGGAGCAGAAGGG + Intergenic
1024038950 7:45534538-45534560 GTGCAGGACCAACTGCAGAGTGG + Intergenic
1024148006 7:46536717-46536739 TCGCTGGATCAGGAGCAGAGAGG + Intergenic
1024332581 7:48170928-48170950 GTGCAGGTGCAGTAGCAGAGTGG + Intergenic
1024583779 7:50823491-50823513 CTACAGGCCAAGGAGCACAGTGG - Intergenic
1024586103 7:50843348-50843370 CTGTAGGACCTGGAGAAGATGGG - Intergenic
1024965139 7:55018066-55018088 CTGCAGGAGAAGGAACAGTGGGG + Intergenic
1026846926 7:73703805-73703827 CGGCAGGACCACGACCAGTGAGG - Exonic
1027812664 7:82925148-82925170 ATGAATGGCCAGGAGCAGAGCGG - Intronic
1028233351 7:88330755-88330777 CAGGATGACCAGGTGCAGAGAGG + Intergenic
1028902663 7:96118687-96118709 GTGGTGGACCAGGAGCAGAGTGG + Intergenic
1029180029 7:98693670-98693692 CTGTAGGACCAAGAGGACAGGGG + Intergenic
1029715717 7:102324403-102324425 CTGCAGGCGCAGGAGCAGCGAGG + Intergenic
1029739553 7:102483673-102483695 CTGCAGCACCCGGAGCAGCCGGG + Exonic
1029757554 7:102582852-102582874 CTGCAGCACCCGGAGCAGCCGGG + Exonic
1029775492 7:102681913-102681935 CTGCAGCACCCGGAGCAGCCGGG + Intergenic
1032074312 7:128829415-128829437 AGGCAGGACCAGGGGCAGAGTGG - Intergenic
1032437314 7:131910717-131910739 CTGCAGGAGCAGAAGCGAAGGGG - Intergenic
1032973717 7:137196528-137196550 CCGAAGGACCAGGAGCAGGACGG - Intergenic
1033361897 7:140643734-140643756 CGCCAGGAACAGGAGAAGAGGGG - Intronic
1033425845 7:141243517-141243539 CTGGAGGAAGGGGAGCAGAGGGG + Intronic
1034410006 7:150935622-150935644 ACGAAGGACCAGCAGCAGAGTGG - Intergenic
1034710081 7:153183657-153183679 CTGCAGTGGCATGAGCAGAGAGG + Intergenic
1034935410 7:155196941-155196963 CACCAGGACCAGCAGCATAGTGG + Exonic
1035068994 7:156127281-156127303 CAGGAAGAACAGGAGCAGAGAGG + Intergenic
1035353795 7:158265223-158265245 TTCCAGCACCAGGAGCATAGTGG - Intronic
1035487312 7:159236187-159236209 CTGCAGGCCCAGGAGGAGTCAGG + Intergenic
1036547703 8:9788092-9788114 GGGCAGGGCCAGAAGCAGAGAGG + Intergenic
1037215766 8:16449234-16449256 CTGCAGGATTTTGAGCAGAGGGG - Intronic
1037388373 8:18366303-18366325 CTGCAGTAGCAGTGGCAGAGAGG - Intergenic
1037777863 8:21847650-21847672 CTGGAGGACCAGCTGCAGAGAGG - Intergenic
1037817908 8:22121379-22121401 CTGCAGGAAAAGCAGTAGAGCGG - Intronic
1038579071 8:28731615-28731637 CTGCAGCACCAGGAACAGGCAGG - Intronic
1038617947 8:29112714-29112736 TTGCAGGGCCAGGAGAAGTGAGG - Intronic
1038785632 8:30612667-30612689 CTGCAGTCCCAGGTGCTGAGAGG - Intronic
1039716111 8:40110739-40110761 TTGCAGGACAAGGGGCAGAGGGG - Intergenic
1039804986 8:40990159-40990181 ATGCAGGATAAGGAGCATAGGGG + Intergenic
1039896421 8:41719625-41719647 CTGCTGGAGAAGGTGCAGAGTGG - Intronic
1040560261 8:48517457-48517479 CTGCAGGTGCAGGGGCAGTGGGG + Intergenic
1042055668 8:64763148-64763170 TTGCTGGATCAGGAGCACAGTGG - Intronic
1042985821 8:74581728-74581750 CTTCAGGATTAGGAGTAGAGAGG + Intergenic
1043559637 8:81476959-81476981 CTCCAGGAACATGTGCAGAGTGG + Intergenic
1043671815 8:82895873-82895895 CTGCAGAATCAGGATCAGAGGGG + Intergenic
1043808272 8:84701636-84701658 CTGGAGGATCAGGAAGAGAGGGG + Intronic
1044008660 8:86965953-86965975 CAGGAGGACCAGCTGCAGAGAGG - Intronic
1044894913 8:96881344-96881366 TGGCAGGAGCAGGAGCAAAGGGG + Intronic
1044927899 8:97224691-97224713 CTGCAGAAGCAGCGGCAGAGGGG - Intergenic
1044972669 8:97634939-97634961 AGGCAGAACCAGGAGCATAGAGG - Intergenic
1046056681 8:109086655-109086677 CAGCAGGAGCAGCAGCAGTGAGG - Exonic
1047052380 8:121127572-121127594 GTACAGGGCCAGGAGAAGAGGGG - Intergenic
1048474971 8:134734695-134734717 ATGCAGGAACTGGACCAGAGGGG + Intergenic
1048972454 8:139652840-139652862 CTGCAGGTTCAGGGGCTGAGGGG - Intronic
1049025916 8:139988757-139988779 CGTCAGCACCAGGAGCAGCGAGG - Exonic
1049043222 8:140128594-140128616 CTGCCGTACAAGGAGCACAGTGG - Intronic
1049166175 8:141127927-141127949 CAGCAGGAAAAGGAGCAGGGTGG - Intronic
1049203901 8:141354500-141354522 GTGCGGGACCAAGGGCAGAGGGG + Intergenic
1049319253 8:141987272-141987294 CTCCAGGGCCAGGGACAGAGGGG + Intergenic
1049540946 8:143208537-143208559 CTGCAGGAACAGGAGAAGGCAGG - Intergenic
1049647454 8:143741986-143742008 CAGCAGGCCCCGGGGCAGAGTGG - Intergenic
1049681565 8:143920912-143920934 GTGGAGGAGCAGGAGCAGAAGGG - Exonic
1049744050 8:144255641-144255663 CTGCAGGCCCAGGAAAGGAGGGG + Exonic
1050598922 9:7231178-7231200 CTGTGGGAAGAGGAGCAGAGGGG + Intergenic
1052799281 9:32952667-32952689 CAGCTGGAGCAGGAGCAGGGTGG + Intergenic
1053128059 9:35598954-35598976 TTTCAGGACCGGGAGCAGACAGG + Intergenic
1053129607 9:35607559-35607581 CTGCAGGGGCAGGGGCAGAGTGG - Intronic
1053141924 9:35688003-35688025 CCGCAGCACCAGGAGCAGATAGG - Intronic
1053739423 9:41124382-41124404 CTGGCAGACCAGGAGCAGGGGGG + Intergenic
1054688928 9:68306940-68306962 CTGGCAGACCAGGAGCAGGGGGG - Intergenic
1055736550 9:79336721-79336743 CTGCTGGATGTGGAGCAGAGAGG + Intergenic
1055923658 9:81488543-81488565 CTCCAGGACCAGCAGCACGGAGG + Intergenic
1056767938 9:89456226-89456248 GTGCCTGGCCAGGAGCAGAGGGG - Intronic
1057397271 9:94691291-94691313 CTGCAGAGGCAGGAGCAGGGTGG - Intergenic
1057510794 9:95678289-95678311 CAGGAGGACCAGCTGCAGAGAGG - Intergenic
1058463420 9:105204755-105204777 ATGCAGGAACAGGAGCAGAAAGG - Intergenic
1059404869 9:114093302-114093324 CAGCAGGGGCAGGAGTAGAGGGG + Exonic
1059532078 9:115044349-115044371 CTCCAGGACCAGGAGAAGACAGG - Intronic
1059958742 9:119544827-119544849 CTCCAGGGCCAGGAACTGAGGGG - Intergenic
1060374030 9:123102625-123102647 CAGCAGCACAAGGAGGAGAGTGG + Intronic
1060665878 9:125431877-125431899 TGGCAGGACTGGGAGCAGAGGGG - Intergenic
1060969538 9:127730361-127730383 CTGCTGCAACAGGAGCACAGAGG + Intronic
1061888779 9:133606703-133606725 CGGTAGGGCCAGGAGCGGAGTGG + Intergenic
1062390989 9:136333791-136333813 GTGGGGGACCAGGAGGAGAGGGG + Intronic
1062424159 9:136498320-136498342 CTGCAGGGCCAGGAGCTGCAGGG + Intronic
1062529612 9:136994161-136994183 CTGCCAGCCCAGGAGCTGAGAGG + Intergenic
1185738081 X:2508290-2508312 CTGCATGACCAGGGGCTGACAGG - Intergenic
1190240573 X:48654973-48654995 TTGCTGGATCAGGAGCACAGCGG - Intergenic
1190278508 X:48914295-48914317 CTGTAGGCCAAGAAGCAGAGAGG + Intronic
1190533789 X:51407056-51407078 CAGCAGGACGAGGGGCAGGGAGG + Exonic
1191743699 X:64463701-64463723 CTGCAGAGGCAGTAGCAGAGAGG + Intergenic
1192209078 X:69116017-69116039 GTGCAGGTCAAGGAGCAGAGAGG + Intergenic
1195065207 X:101233651-101233673 CTGCTGGAAAAGGAGAAGAGTGG + Intronic
1196772513 X:119309085-119309107 TTGCTGGATCAGGAGCACAGTGG + Intergenic
1197726116 X:129777592-129777614 CTGCGTGACCAGGAGCAGGAGGG - Intergenic
1197812238 X:130455524-130455546 TGGCAGGAGCAGGAGCAAAGGGG - Intergenic
1198566827 X:137913840-137913862 TTGCTGGATCAGGAGCACAGCGG + Intergenic
1199360001 X:146907027-146907049 CAGGATGACCAGCAGCAGAGAGG - Intergenic
1199967539 X:152832388-152832410 CTCCAGGACCTAGAACAGAGAGG + Intronic
1199972841 X:152873306-152873328 CTGCAGGACCAGGTGCCCTGAGG - Intergenic
1202124604 Y:21557021-21557043 CAGGAAGACCAGGAGAAGAGGGG - Intergenic
1202154404 Y:21872359-21872381 CAGGAAGACCAGGAGAAGAGGGG + Intergenic