ID: 1161955060

View in Genome Browser
Species Human (GRCh38)
Location 19:7489083-7489105
Sequence CGCCCCAAAGGCTTGCGCGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 37
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 32}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161955056_1161955060 -3 Left 1161955056 19:7489063-7489085 CCAGGCCGGGGTACCGGGAGCGC 0: 1
1: 0
2: 0
3: 11
4: 140
Right 1161955060 19:7489083-7489105 CGCCCCAAAGGCTTGCGCGCAGG 0: 1
1: 0
2: 0
3: 4
4: 32
1161955048_1161955060 15 Left 1161955048 19:7489045-7489067 CCGCGCCAGGGGGCGGGGCCAGG 0: 1
1: 0
2: 5
3: 46
4: 475
Right 1161955060 19:7489083-7489105 CGCCCCAAAGGCTTGCGCGCAGG 0: 1
1: 0
2: 0
3: 4
4: 32
1161955051_1161955060 10 Left 1161955051 19:7489050-7489072 CCAGGGGGCGGGGCCAGGCCGGG 0: 1
1: 0
2: 15
3: 157
4: 1013
Right 1161955060 19:7489083-7489105 CGCCCCAAAGGCTTGCGCGCAGG 0: 1
1: 0
2: 0
3: 4
4: 32
1161955057_1161955060 -8 Left 1161955057 19:7489068-7489090 CCGGGGTACCGGGAGCGCCCCAA 0: 1
1: 0
2: 0
3: 3
4: 44
Right 1161955060 19:7489083-7489105 CGCCCCAAAGGCTTGCGCGCAGG 0: 1
1: 0
2: 0
3: 4
4: 32

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161955060 Original CRISPR CGCCCCAAAGGCTTGCGCGC AGG Intronic