ID: 1161958069

View in Genome Browser
Species Human (GRCh38)
Location 19:7507136-7507158
Sequence CAGCGGGTAAGGGAGGCGGA GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 295
Summary {0: 1, 1: 1, 2: 1, 3: 21, 4: 271}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161958060_1161958069 -1 Left 1161958060 19:7507114-7507136 CCCGGTGACTGAAGAGATGCTAC 0: 1
1: 0
2: 2
3: 8
4: 112
Right 1161958069 19:7507136-7507158 CAGCGGGTAAGGGAGGCGGAGGG 0: 1
1: 1
2: 1
3: 21
4: 271
1161958059_1161958069 0 Left 1161958059 19:7507113-7507135 CCCCGGTGACTGAAGAGATGCTA 0: 1
1: 0
2: 1
3: 6
4: 73
Right 1161958069 19:7507136-7507158 CAGCGGGTAAGGGAGGCGGAGGG 0: 1
1: 1
2: 1
3: 21
4: 271
1161958055_1161958069 19 Left 1161958055 19:7507094-7507116 CCACACAGAACACCTCCGGCCCC 0: 1
1: 0
2: 0
3: 16
4: 165
Right 1161958069 19:7507136-7507158 CAGCGGGTAAGGGAGGCGGAGGG 0: 1
1: 1
2: 1
3: 21
4: 271
1161958057_1161958069 7 Left 1161958057 19:7507106-7507128 CCTCCGGCCCCGGTGACTGAAGA 0: 1
1: 0
2: 0
3: 7
4: 77
Right 1161958069 19:7507136-7507158 CAGCGGGTAAGGGAGGCGGAGGG 0: 1
1: 1
2: 1
3: 21
4: 271
1161958061_1161958069 -2 Left 1161958061 19:7507115-7507137 CCGGTGACTGAAGAGATGCTACA 0: 1
1: 0
2: 0
3: 9
4: 120
Right 1161958069 19:7507136-7507158 CAGCGGGTAAGGGAGGCGGAGGG 0: 1
1: 1
2: 1
3: 21
4: 271
1161958058_1161958069 4 Left 1161958058 19:7507109-7507131 CCGGCCCCGGTGACTGAAGAGAT 0: 1
1: 0
2: 0
3: 10
4: 164
Right 1161958069 19:7507136-7507158 CAGCGGGTAAGGGAGGCGGAGGG 0: 1
1: 1
2: 1
3: 21
4: 271

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161958069 Original CRISPR CAGCGGGTAAGGGAGGCGGA GGG Exonic
900266444 1:1759617-1759639 CAGCGGGGATGGGAAGCGGGAGG + Intronic
901634473 1:10664220-10664242 GAGCGGGCAGGGGAGGCGCAGGG + Intronic
901687799 1:10953761-10953783 GAGGGGACAAGGGAGGCGGATGG - Intronic
901728723 1:11262512-11262534 CAGCGGGGAAGGCGGGCGGTGGG - Intergenic
902142337 1:14367250-14367272 CAGCGGGAAAGGAAGCTGGAAGG + Intergenic
903943797 1:26949502-26949524 CAGCAGTTAAGTGAGGCAGATGG + Intergenic
905315418 1:37079748-37079770 GAGAGGGAGAGGGAGGCGGAGGG - Intergenic
907338489 1:53716281-53716303 CAGGGGGAGAGGGAGGCAGAGGG + Intronic
907425409 1:54376127-54376149 CAGAGACTAAGGGAGGAGGAGGG - Intronic
907706787 1:56839403-56839425 CAGTGGGAAAGGGAGCTGGAAGG + Intergenic
908180212 1:61596496-61596518 CTGTGTGTAAGGGAGGTGGAGGG - Intergenic
908501144 1:64745034-64745056 CCGCGGGGAAGGGGGGCGGTGGG - Intergenic
912378947 1:109236149-109236171 CAGCTGGTAAGGGTGGCGTCTGG - Intronic
912852756 1:113141179-113141201 CAGAGGGAACGGGAGGCAGAAGG - Intergenic
913056007 1:115160063-115160085 GAGGGGGAAAGGGAGGGGGAGGG + Intergenic
913177293 1:116286515-116286537 CAGCTGCTATGGGAGGAGGATGG + Intergenic
913341091 1:117758825-117758847 CAGCCGGAGAGGGAGGAGGAGGG + Intergenic
915073805 1:153293077-153293099 CAGAGGGTAAGGGGGAAGGATGG + Intergenic
917343862 1:174008443-174008465 AAGAGGGGAAGGGAGGAGGAGGG + Intronic
918236820 1:182589150-182589172 GAGCAGGTAAGGCAGGCAGAAGG - Exonic
919820600 1:201469437-201469459 TGGCGGGGAAGGGAGGGGGAAGG + Intergenic
920293454 1:204940584-204940606 CAGAGGGGAAGGGAGAAGGAGGG - Intronic
920973617 1:210765242-210765264 CAGGGGGTAATGGTGGCGGGTGG + Intronic
922468801 1:225862689-225862711 CAGCTAGGAAGGGAGGCGGGAGG - Intronic
923093820 1:230759332-230759354 GAGCAGGCAAGGGAGGCAGAAGG + Intronic
1063353119 10:5374229-5374251 CAGCGGGGTGGGGAGGGGGAGGG + Exonic
1063368822 10:5507833-5507855 CAGCAGGTAGGGGAGGCGACAGG - Intergenic
1063664243 10:8051968-8051990 CAGCGGGGAAGGGAAAAGGATGG - Intergenic
1063681255 10:8189710-8189732 GGGCGGGAAATGGAGGCGGAAGG + Intergenic
1064859777 10:19815592-19815614 CAGCGCGGGAGGGTGGCGGAAGG - Intergenic
1073476346 10:103756441-103756463 CAGCGGGTGATGGTGGTGGAGGG - Intronic
1075122654 10:119675775-119675797 AAGGGGGGAAGGGAGGGGGAGGG - Intronic
1075780411 10:125013673-125013695 CAGCAGGTAACGGAGGCGGGGGG + Intronic
1079116600 11:17644063-17644085 CTGGGGGCAAGGGAGGGGGAGGG + Intronic
1079372185 11:19861030-19861052 CAGAGGGAGAGGGAGGGGGAGGG + Intronic
1082904991 11:58298038-58298060 GAGAGGGTAAGGGAGTGGGAAGG - Intergenic
1083822598 11:65181626-65181648 CCGCGGGGAACGGAGGGGGAGGG - Exonic
1089432611 11:118436446-118436468 CAGGGGGGCGGGGAGGCGGAGGG - Intergenic
1090367904 11:126223152-126223174 CAGCGAGTGAGGGAGGGGGCTGG + Intronic
1091386574 12:99800-99822 AAGCGGGACAGGGAGGCAGAGGG - Intronic
1091898042 12:4120449-4120471 CACAGGGGAAGGGAGGGGGAAGG - Intergenic
1092108602 12:5943503-5943525 CAGCGGGTAAGGGTGGGAGGAGG + Intronic
1092229598 12:6769212-6769234 GGGCAGGCAAGGGAGGCGGAGGG + Intronic
1092245083 12:6859593-6859615 CAGGCGGTCAGGGAGGAGGAAGG - Intronic
1092253490 12:6914409-6914431 GAGTGGGGAAGGGAGGAGGATGG - Intronic
1095430132 12:42125147-42125169 CAACGGTTAAGGGAGAAGGAAGG + Intronic
1096257726 12:50073311-50073333 CAGTGGGAAAGGGAGGCTGATGG - Intronic
1096466383 12:51849174-51849196 CGGCGGGTAGGGGTGGGGGACGG + Intergenic
1096755503 12:53796176-53796198 CAGCAGCTAAGGGAGGGAGATGG - Intergenic
1097153141 12:56994350-56994372 CAGCGGGTGAGGGAGGAGCTGGG + Intergenic
1098369158 12:69738938-69738960 CAGCGAGAAACGGAGGAGGACGG - Intronic
1099972282 12:89512649-89512671 CAGAGGCTGAGGGAGGCGGGCGG + Intronic
1100347014 12:93742399-93742421 CAGCGGGGCAGGGAGGCGCGCGG + Intronic
1103961452 12:124611533-124611555 CAGCCGGTACGCGAGGCAGAGGG - Intergenic
1105437579 13:20391226-20391248 TAGGGGGAAAGGGAGGCGGGGGG + Intergenic
1105724438 13:23147768-23147790 CAGCAGATAAGGGAGCCAGAAGG + Intergenic
1106086485 13:26546897-26546919 AAGAGGGTAAGGGTGGCTGAAGG - Intergenic
1106269231 13:28138298-28138320 AAGCGGGTGGGGAAGGCGGAGGG - Intergenic
1107935365 13:45341382-45341404 CAGCGGGTAGGGGTGGGGGCGGG + Intergenic
1108146626 13:47483999-47484021 CAGAGGGGAAGGGAAGCAGAAGG - Intergenic
1108327508 13:49348326-49348348 CAGGGGCCAAGGCAGGCGGATGG + Intronic
1108396616 13:49996868-49996890 CGACGGGGAAGGGAGGGGGAGGG + Intronic
1111396257 13:87672504-87672526 CGGCGGGATAGGGAGGCGGCGGG - Intergenic
1111947778 13:94683448-94683470 CAGCTGGGAAGGGATGCAGAGGG + Intergenic
1113566880 13:111324619-111324641 GAGAGGGCAAGGGAGGTGGATGG + Intronic
1113660863 13:112105576-112105598 GCGCGGGTGCGGGAGGCGGAGGG + Intergenic
1114215751 14:20656554-20656576 GAGAGGGTAAGGGAGATGGAAGG - Intergenic
1114720466 14:24875805-24875827 CAAGGGGTAAGGGTGGCGGGAGG + Intronic
1117419896 14:55534058-55534080 CAGCAGGAAAGGGAGGCCGTGGG + Intergenic
1121312370 14:92942051-92942073 CAGCAGATAAGGGGGGCTGAGGG + Intronic
1121676460 14:95757349-95757371 GAGGGGGAAAGGGAGGTGGATGG - Intergenic
1122298247 14:100717503-100717525 CAGGGTGTAAGGAAGCCGGAGGG - Intergenic
1122758882 14:104005502-104005524 TAGCGGGAAAGTGAGGCGGGAGG - Intronic
1124058541 15:26265231-26265253 CAGCGGGTAAGGGAGGAGGAAGG - Intergenic
1124264242 15:28219390-28219412 CTGCAGGCAAGGGAGGCTGAGGG + Intronic
1124872731 15:33559084-33559106 CAGAGGGTAAAGGAGGAGGTTGG + Intronic
1126345553 15:47690026-47690048 CATAGAGAAAGGGAGGCGGATGG - Intronic
1126634134 15:50765451-50765473 CAGCTGGTAAGGGGGCGGGAAGG - Exonic
1127995984 15:64153334-64153356 CTGGGGGTAAGGGGGGCCGATGG + Exonic
1131052381 15:89357432-89357454 CAGCGGGGAAGGGAGGATGAAGG + Intergenic
1131510995 15:93049369-93049391 CAGCGGGGAAAGGAAGGGGAAGG + Intronic
1132685035 16:1158681-1158703 AAGCGGGTCTGGGAGGCGCACGG - Intronic
1132868209 16:2104174-2104196 CAGGGGGAAAGGGAGGGGAAGGG + Intronic
1133061764 16:3179520-3179542 CAGCAGGTCAGGGAAGCGGACGG - Intergenic
1134108224 16:11499120-11499142 AAGGGGGGAAGGGAGGCAGAGGG + Intronic
1134108235 16:11499143-11499165 GAGGGGGGAAGGGAGGCAGAGGG + Intronic
1134108257 16:11499188-11499210 GAGGGGGGAAGGGAGGCAGAGGG + Intronic
1134108268 16:11499211-11499233 GAGGGGGGAAGGGAGGCAGAGGG + Intronic
1134108279 16:11499234-11499256 GAGGGGGGAAGGGAGGCAGAGGG + Intronic
1134108290 16:11499257-11499279 GAGGGGGGAAGGGAGGCAGAGGG + Intronic
1134108301 16:11499280-11499302 GAGGGGGGAAGGGAGGCAGAGGG + Intronic
1134719008 16:16370736-16370758 CAGGGGGAAAGGGAGGGGAAGGG - Intergenic
1134955672 16:18381259-18381281 CAGGGGGAAAGGGAGGGGAAGGG + Intergenic
1138691891 16:58776186-58776208 CAGGGGGTAGGGTAGGGGGAGGG + Intergenic
1139910900 16:70396920-70396942 CAGGGGCTAAGGGAGGTGAAGGG - Intronic
1141173328 16:81704440-81704462 AAGTGGGTAGGGGAGGGGGAGGG - Intronic
1141436106 16:84000821-84000843 CAGCAGGTGAGGGAGACAGAGGG + Intronic
1141800313 16:86303670-86303692 CAGCGTGCAAGGGAGGATGAAGG + Intergenic
1142539545 17:647523-647545 CAGCGGATGGGGGAGGAGGAAGG - Intronic
1142756352 17:2018622-2018644 CAGAGGGCAAGGGAGACGGTGGG + Intronic
1146627368 17:34444812-34444834 CAGCTGGTAAGAGAGGAGGCAGG + Intergenic
1147727383 17:42574715-42574737 GAGAGGGAAAGGGAGGGGGAAGG - Intronic
1147742270 17:42676111-42676133 CAGCGGGGAAGGGAGAGGCAGGG + Intronic
1147839571 17:43361763-43361785 CGGAGGGGAAGGGAGGCGGAGGG - Intergenic
1147930425 17:43977168-43977190 CAGCGGGGCAGGGAGAGGGAGGG + Intronic
1148059855 17:44829472-44829494 AAGCGGGAAAGCGGGGCGGAAGG - Intronic
1149443472 17:56694980-56695002 CAGGGGTTAGGGGAGGGGGAAGG - Intergenic
1149457808 17:56802471-56802493 AAAGGGGTAAGGGAGGCAGACGG - Intronic
1150331274 17:64296492-64296514 CAGTGGGTCAGGGAGTTGGAAGG - Intergenic
1152288789 17:79427153-79427175 TAGCTGGTAAGAGATGCGGACGG + Intronic
1152593259 17:81223835-81223857 CAGCAGGTACGGGATCCGGAGGG - Intergenic
1153951807 18:10064148-10064170 CAGTGGGTAGGTGAGGAGGAAGG - Intergenic
1156700501 18:39819076-39819098 AAGCGGGGAAGGGAGGGGGGAGG + Intergenic
1157374586 18:47151032-47151054 CAGCGGGTTAGGGAGGGAGGTGG - Intronic
1158015689 18:52780763-52780785 CAGGGGAGAAGGGAGGAGGAAGG + Intronic
1160464835 18:79068383-79068405 CAGCGGGTGATGGAGGTGGAAGG + Intergenic
1160705125 19:525947-525969 CAGAGGGGAGGGGAGGAGGAGGG + Intergenic
1161159571 19:2754492-2754514 CAGCTGGGGACGGAGGCGGAGGG + Intergenic
1161506781 19:4648445-4648467 CAATGGGTCAGGGAGGAGGAAGG + Intronic
1161537534 19:4829396-4829418 CAGTGGGCAGGGGAGGCGGGCGG - Intronic
1161659878 19:5539522-5539544 CAGCGGGGAGGGGAGGGGAAGGG + Intergenic
1161842917 19:6693578-6693600 CAGGGGCTCAGGGTGGCGGAGGG + Intronic
1161958069 19:7507136-7507158 CAGCGGGTAAGGGAGGCGGAGGG + Exonic
1162969059 19:14169415-14169437 CAGCGGGGAAGGGGGGTGGGAGG - Intronic
1163004545 19:14389229-14389251 AAGGGGGAAAGGGAGGGGGATGG + Intronic
1165467369 19:35982891-35982913 CAGCAGGTACAGGAGGAGGAAGG - Intergenic
1165880027 19:39035885-39035907 CAGAGGCTAAGGCAGGAGGATGG - Intergenic
1167417956 19:49386887-49386909 CAGAGGGGAAGAGAGGGGGAGGG + Intergenic
1167417991 19:49386972-49386994 CAGAAGGGAAGGGAGGCGGGAGG + Intergenic
1167960982 19:53103688-53103710 CCGCGGGGGAGGGAGGCAGAGGG + Intergenic
925228618 2:2209373-2209395 CAGGGGGTAGGGGAGTTGGAAGG - Intronic
925594325 2:5540025-5540047 CAGGCGGTGAGGGAGGTGGAGGG + Intergenic
925855184 2:8122661-8122683 CAGCTGGAATGGGAGGCAGAGGG + Intergenic
926055373 2:9771220-9771242 CAGCGAGTGAGGGAGGAGGCAGG - Intergenic
926139089 2:10357873-10357895 CAGCTGGGAAGGGAGAGGGAGGG + Intronic
926707440 2:15846657-15846679 CAGAGGCTCAGGGAGGCTGAGGG + Intergenic
926911327 2:17854007-17854029 CTGAGGGGAGGGGAGGCGGAGGG + Intergenic
928796796 2:35033161-35033183 CAGTGGGTAAGAGGGGCAGAGGG + Intergenic
931340715 2:61398421-61398443 GAAAGGGTAAGGGAGGAGGAGGG + Intronic
933278171 2:80304400-80304422 CAGAGGGAAAGGAAGGCGGCAGG - Exonic
933812626 2:86042593-86042615 CAGAGGGAAAGGCAGGAGGAAGG + Intronic
934987795 2:98900150-98900172 CAGTGGGAAGGGGAGGCAGATGG + Intronic
940527356 2:154833697-154833719 CAGGGGTTTAGGGAGACGGAGGG - Intronic
940658984 2:156523248-156523270 CAGGGGTTAGGGGAGGGGGAAGG - Intronic
940748412 2:157596997-157597019 CTGCGGGTAAGGGACGGGGCAGG + Intronic
944547449 2:200812047-200812069 CAGAGGGAGAGGGAGGCGGCGGG + Intronic
945530636 2:210950114-210950136 CAGAGGGAGAGGGAGGGGGAGGG - Intergenic
946422268 2:219571500-219571522 CAGCGGGCAGGGGAGGCTGCGGG - Intronic
1168794520 20:602691-602713 CAGCGGGGAAGTGAGGTAGAGGG + Intergenic
1171477223 20:25420664-25420686 CAGCTGGTCAGGGAGGCTGAGGG + Intronic
1171961319 20:31496992-31497014 CAGTGGGTGAAGGAGCCGGAGGG + Intergenic
1172423928 20:34842260-34842282 CAGAGGGGAAGGGAAGGGGAGGG + Intergenic
1172912744 20:38422046-38422068 CAGCGCTCAAGGGAGGAGGACGG + Intergenic
1173009356 20:39167780-39167802 CAGTGGGTTAGGGAGGAGGTAGG - Intergenic
1174806584 20:53608769-53608791 CAGCGGCTGAGGGCGGCGGCAGG - Intronic
1175224846 20:57439157-57439179 CAGGGGGTTAGGGAGGTGGGGGG - Intergenic
1175825925 20:61936481-61936503 CTGTGGGCAGGGGAGGCGGAGGG - Intronic
1176005844 20:62861882-62861904 CGGCGGGTAACGGAGGGGGCGGG - Intergenic
1176312242 21:5158244-5158266 CAGCGTGTGAGGTAGGGGGAGGG + Intergenic
1179209474 21:39313331-39313353 CGGCGGGGAGGGGAGGGGGACGG + Intronic
1179726468 21:43343987-43344009 CAGCGGGGGAGGCAGCCGGAGGG - Intergenic
1179844806 21:44103786-44103808 CAGCGTGTGAGGTAGGGGGAGGG - Exonic
1180387490 22:12192115-12192137 CAGAGGGTGAGGTAGGAGGATGG - Intergenic
1181044469 22:20207961-20207983 CAGCAGGCAAGGTAGGGGGACGG - Intergenic
1182705646 22:32277979-32278001 CAGCTGGTTAGGCAGGGGGAAGG + Intergenic
1183428633 22:37752639-37752661 CAGCGGGTAGGGAAGGCTGTGGG - Intronic
1183516977 22:38272565-38272587 CCCCGGGAGAGGGAGGCGGATGG - Intronic
1183547085 22:38460170-38460192 CAGCGGGAAAGGTTGGCGGAGGG - Intergenic
1184662362 22:45971227-45971249 CCGCGTGTAAAGGAGGGGGAGGG + Intronic
1184812641 22:46847039-46847061 CAGCCGATAAGGAAGGCTGATGG - Intronic
1185229761 22:49673456-49673478 CAGAGGGCAGGGGAGGGGGAAGG + Intergenic
950101486 3:10359604-10359626 CAGCGGCTTAGGGAGGAGAAGGG + Intronic
950774926 3:15341206-15341228 CAGAGGGTGAGCGAGGAGGAGGG - Intronic
952439730 3:33313685-33313707 CAGGAGGTAAGGCAGGAGGATGG - Intronic
954354438 3:50073142-50073164 CAGGGGATAAAGGAGGAGGATGG - Intronic
954807531 3:53229208-53229230 CAGGAGGTATGGGAGGGGGATGG - Intronic
957100353 3:75819062-75819084 CAGGTGGTGAGGGAGGAGGAGGG - Intergenic
962337664 3:134550873-134550895 CAGTGGGCAAGGGAGGCAGAGGG + Intronic
963086015 3:141437338-141437360 CAGAGAGTAAGGGAGGCAGAAGG - Intronic
967250601 3:187534172-187534194 CACCGGTTATGGGAGGAGGAAGG - Intergenic
968086940 3:195878038-195878060 CAGTGGGAAAGGGTGGTGGAGGG + Intronic
968910007 4:3472857-3472879 CAGGGGGTAGGGGAGGTCGATGG - Intronic
969226956 4:5804957-5804979 CAGCGGGTGAGGAAGGCCGATGG - Intronic
969431800 4:7159436-7159458 AAGCAGGTAAGGGAGGCGGTGGG - Intergenic
970123806 4:12787147-12787169 CAGAGGGTAAGGAGGGAGGATGG - Intergenic
970533454 4:17005540-17005562 AAGCGGGGGAGGGAGGCGGGGGG - Intergenic
975405244 4:73981558-73981580 GAGAGGGTAAGAGAGGAGGAGGG + Intronic
975786966 4:77900990-77901012 TAGGGGGTAAGGGAGGGGGAAGG + Intronic
976897497 4:90128657-90128679 CAAGGGGTAAGGGTGACGGAGGG + Intronic
981086436 4:140689381-140689403 AAGCGGGGAAGGAAGGAGGAAGG - Intronic
982959448 4:161818280-161818302 CAGCAGGTGGGGGAGCCGGAAGG - Intronic
985563129 5:601976-601998 CAGGGAGCAAAGGAGGCGGAGGG - Intergenic
987304808 5:16627462-16627484 GAGCGGCAAAGGGAGGTGGAAGG - Intergenic
997452044 5:133991632-133991654 CAGCGGGTAATAGAGGAGAATGG - Intronic
997631599 5:135373012-135373034 CAGAGAGGAAGGGAGGCAGAAGG + Intronic
999629096 5:153551732-153551754 CAGGGGTTCAGGGAGGAGGATGG - Intronic
1001731378 5:173962945-173962967 CAGCGGGTGAGGGGTGCTGAGGG - Intergenic
1001971246 5:175956611-175956633 CAGCGGGTGAAGGAGGAGGGGGG - Intronic
1002001762 5:176200024-176200046 GAGCTGGTTAGGGAGGGGGAAGG + Intergenic
1002246196 5:177887166-177887188 CAGCGGGTGAAGGAGGAGGGGGG + Intergenic
1003261017 6:4516157-4516179 CTGCGGGTGGGGGAGGCGGTGGG + Intergenic
1003839707 6:10107279-10107301 CAGAGGGTAAGAGAGAGGGAGGG - Intronic
1004533572 6:16477601-16477623 CAGAGGTCAAGGGAGGCAGAAGG - Intronic
1005118900 6:22368901-22368923 CAGAGGGGAATGGAGGTGGAGGG + Intergenic
1006336840 6:33425417-33425439 AAGGGGGTAAGGGAGGTGGGAGG + Intronic
1006634631 6:35452817-35452839 TAGCAGGTATGGGAGGCGGGGGG + Intronic
1007105962 6:39283114-39283136 AAGCTGGGAAGGGAGGAGGAAGG - Intergenic
1007617932 6:43193072-43193094 GAGCAGGTAAAGGAGGCGCAGGG - Exonic
1011816446 6:91196933-91196955 CAGTGGTTAAAAGAGGCGGAAGG + Intergenic
1011868473 6:91861837-91861859 CAGAGGCTAAGGGGGGAGGACGG + Intergenic
1012033597 6:94103615-94103637 AAGGGGGTAAGGGAGGGGCATGG - Intergenic
1013663698 6:112325393-112325415 CAAGAGGAAAGGGAGGCGGAGGG + Intergenic
1018298627 6:162376759-162376781 GAGAGGGAAAGGGAGGGGGAGGG + Intronic
1018654671 6:166024161-166024183 TAGGGGGAGAGGGAGGCGGATGG + Intergenic
1018669523 6:166167596-166167618 CGGCGGGGAGGGGAGCCGGACGG - Exonic
1019575621 7:1736288-1736310 CAGGGGGAAAGGTGGGCGGAGGG - Intronic
1020440249 7:8209925-8209947 CAGCAGGGAAGAGAGGCGGGAGG + Intronic
1021559469 7:21955510-21955532 CAGGGGTTAAGGAAGGAGGAAGG - Intergenic
1021680032 7:23120974-23120996 TAGAGGGAAGGGGAGGCGGAAGG - Intronic
1021858551 7:24882249-24882271 CAGCAGGTGAGGGTGGGGGAGGG - Intronic
1023160401 7:37291926-37291948 CAGAGGGAGAGGGAGGGGGAGGG - Intronic
1023966207 7:44964234-44964256 CAGCGGGGAGGGGAGGCAGTAGG - Intronic
1024356404 7:48417597-48417619 CTGGGGGCAAGGGAGGCAGAGGG - Intronic
1029448167 7:100626469-100626491 CAGCGGGGAGGGGTGGGGGAGGG + Intronic
1029590715 7:101505048-101505070 CAGAGGCTGAGGGAGGAGGATGG + Intronic
1033313756 7:140281259-140281281 GAGCTGGCAAGGGAGGGGGATGG + Intergenic
1034265322 7:149777848-149777870 CAGCGGGTGAGGGAGGGAGATGG + Intergenic
1034681924 7:152935350-152935372 CACCTGTTACGGGAGGCGGAAGG + Intergenic
1035413764 7:158667294-158667316 TAGCGGCTAAGGGTGGAGGAGGG - Intronic
1035413794 7:158667396-158667418 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035413804 7:158667425-158667447 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035413814 7:158667454-158667476 TAGTGGGTAAGGCGGGCGGAGGG - Intronic
1035413824 7:158667483-158667505 TAGTGGGTAAGGCGGGCGGAGGG - Intronic
1035413883 7:158667654-158667676 TAGTGGGTAAGGAAGGCGGAGGG - Intronic
1035413892 7:158667683-158667705 TAGTGGGTAAGGCGGGCGGAGGG - Intronic
1035413934 7:158667800-158667822 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035413955 7:158667859-158667881 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035413965 7:158667888-158667910 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035413994 7:158667973-158667995 TAGTGGGTAAGGAAGGCGGAGGG - Intronic
1035414003 7:158668002-158668024 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035414024 7:158668061-158668083 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035414034 7:158668090-158668112 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035414124 7:158668350-158668372 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035587276 8:785866-785888 CAGCGGGTGAGGGAGGAGGGAGG - Intergenic
1035728903 8:1841388-1841410 AAGGGGGTCAGAGAGGCGGATGG + Intronic
1036692393 8:10952014-10952036 CAGTGGGTAGGGGAGTGGGAAGG + Intronic
1037438587 8:18890807-18890829 CTGGGGGTAAGGGTGGGGGAGGG + Intronic
1037535116 8:19817006-19817028 CAGAGGGTCGGGGAGGCGGCGGG - Intergenic
1038134423 8:24770084-24770106 CAGTGGGTCAGGGATGCGCATGG - Intergenic
1038248597 8:25881934-25881956 CAGCAGATAAGGGAGCCAGAAGG - Intronic
1038551993 8:28478449-28478471 CAAGGGGTAAGGGAGGGAGAGGG - Intronic
1039763269 8:40600802-40600824 CAGCTGGGAAGGGATGGGGATGG - Intronic
1039963732 8:42269413-42269435 CAGCTGGGAAGGGAAGGGGAGGG + Intergenic
1040645602 8:49392843-49392865 CAGGAGGTAAGGGAGGAGAATGG + Intergenic
1040994622 8:53389316-53389338 CAGCGGTGAAGGGAGGTGGGTGG - Intergenic
1042359468 8:67866439-67866461 CAGCAGGTAAGGGAAGAGAAAGG - Intergenic
1042570921 8:70163738-70163760 AGGTGGGTAAGGGAGACGGAGGG + Intronic
1049237333 8:141518786-141518808 CGGCGGGGAAGGGGGGCGGTGGG + Intergenic
1049368847 8:142253866-142253888 CAGTGGGTGAGGGAGGTGGGAGG + Intronic
1049414013 8:142487274-142487296 CAGCGGGGAATGGGGGCAGACGG - Intronic
1049545376 8:143228373-143228395 CTGCGGGAGAGGGAGGCGGGGGG + Intergenic
1049612167 8:143560821-143560843 CGGCGGGTGACGGAGGCGGCGGG + Intronic
1049710401 8:144060606-144060628 CAGCGGGGAAGGGCCGCGGAGGG + Intronic
1049725299 8:144142928-144142950 CAGCTGGCTGGGGAGGCGGAGGG + Intergenic
1050798613 9:9579848-9579870 CAGAGGGTAAGGGAGTGGGAGGG - Intronic
1051335743 9:16064404-16064426 GAGAGGGTGAGGGAGGCTGAGGG + Intergenic
1052022148 9:23537896-23537918 CTAAGGGTAAGGGAGGGGGAGGG + Intergenic
1052043547 9:23768595-23768617 CAGTGGGTGAGGGTGGCTGATGG - Intronic
1052951927 9:34219967-34219989 CAGAGGGGAAGGGAGAGGGAAGG - Intronic
1057258375 9:93568807-93568829 CAGTGGGGAAGGGTGGGGGAAGG + Intergenic
1058103106 9:100938225-100938247 CAGTGGGTATGGGAAGTGGATGG + Intergenic
1059754744 9:117281980-117282002 CAGCGAGTAAGAGAAGCAGATGG - Intronic
1060147939 9:121268214-121268236 CAGCAGGTAGGGGAGGCGCGCGG + Intronic
1060810905 9:126611137-126611159 CAGCGGGGAAGGCATGCAGAGGG + Intergenic
1061418044 9:130458614-130458636 CAGAGGGAGATGGAGGCGGAGGG + Intronic
1061634832 9:131900953-131900975 AAGAGGGTAAGGGAGAAGGAGGG + Intronic
1061800943 9:133113125-133113147 CAGCGGGTAGAGGAGCCGGGGGG + Intronic
1061803685 9:133126778-133126800 CAGCGGGAGAGGGAGGCAGCAGG + Intronic
1061804025 9:133128265-133128287 CAGCGGGAGAGGGAGGCAGCAGG + Intronic
1186047297 X:5550380-5550402 CAGAGGGAAAGGGAGGCGGAGGG - Intergenic
1186592188 X:10942534-10942556 CAGTGGGTAGGGGAGGGGAATGG - Intergenic
1189161819 X:38817156-38817178 CAGTGGGGAGGGGAGGGGGATGG - Intergenic
1190739676 X:53280750-53280772 CAGCAGGGCAGGGAGGCTGAGGG + Intronic
1192315522 X:70048420-70048442 CAGTGGTTAAGTGAGGTGGAGGG - Intronic
1193219724 X:78910132-78910154 CAGGGGGGATGGGAGGGGGATGG + Intergenic
1193819416 X:86144083-86144105 GAGGGGAGAAGGGAGGCGGAGGG + Intergenic
1195278952 X:103310843-103310865 GAGCAGGTAAGGGACCCGGAGGG - Exonic
1198214784 X:134545872-134545894 CAGCGGGGAAGGGAGGGCGAGGG + Intergenic
1198519940 X:137442343-137442365 CAGCTGGGAAGTGAGGTGGAGGG - Intergenic
1200037377 X:153340788-153340810 AAGAGGGTAAGGGAAGGGGAGGG - Intronic
1200133811 X:153865050-153865072 CAGCAGGGAAGGGAGGTGGAGGG - Intronic
1200223565 X:154404388-154404410 CAGAGGGCAAGGGAGGCTGCAGG - Intronic
1200249843 X:154547046-154547068 CAGCGGGTATGGCAGGCAGCCGG - Exonic
1200656844 Y:5912666-5912688 GAGGGGGAAAGGGAGGGGGAAGG + Intergenic
1201238082 Y:11930794-11930816 CAGCAGATAGGGGAGGCAGAGGG - Intergenic