ID: 1161959505

View in Genome Browser
Species Human (GRCh38)
Location 19:7516109-7516131
Sequence CGCTCCCCGGGAGCGCCTGG CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 163
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 145}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161959497_1161959505 -6 Left 1161959497 19:7516092-7516114 CCTCGGCCGGCCCCTCTCGCTCC 0: 1
1: 0
2: 2
3: 34
4: 480
Right 1161959505 19:7516109-7516131 CGCTCCCCGGGAGCGCCTGGCGG 0: 1
1: 0
2: 1
3: 16
4: 145
1161959496_1161959505 -5 Left 1161959496 19:7516091-7516113 CCCTCGGCCGGCCCCTCTCGCTC 0: 1
1: 0
2: 1
3: 16
4: 164
Right 1161959505 19:7516109-7516131 CGCTCCCCGGGAGCGCCTGGCGG 0: 1
1: 0
2: 1
3: 16
4: 145
1161959494_1161959505 5 Left 1161959494 19:7516081-7516103 CCCGCTGCGGCCCTCGGCCGGCC 0: 1
1: 0
2: 2
3: 27
4: 273
Right 1161959505 19:7516109-7516131 CGCTCCCCGGGAGCGCCTGGCGG 0: 1
1: 0
2: 1
3: 16
4: 145
1161959491_1161959505 14 Left 1161959491 19:7516072-7516094 CCAGCAGCTCCCGCTGCGGCCCT 0: 1
1: 0
2: 1
3: 45
4: 440
Right 1161959505 19:7516109-7516131 CGCTCCCCGGGAGCGCCTGGCGG 0: 1
1: 0
2: 1
3: 16
4: 145
1161959495_1161959505 4 Left 1161959495 19:7516082-7516104 CCGCTGCGGCCCTCGGCCGGCCC 0: 1
1: 0
2: 1
3: 45
4: 341
Right 1161959505 19:7516109-7516131 CGCTCCCCGGGAGCGCCTGGCGG 0: 1
1: 0
2: 1
3: 16
4: 145
1161959490_1161959505 15 Left 1161959490 19:7516071-7516093 CCCAGCAGCTCCCGCTGCGGCCC 0: 1
1: 0
2: 1
3: 27
4: 343
Right 1161959505 19:7516109-7516131 CGCTCCCCGGGAGCGCCTGGCGG 0: 1
1: 0
2: 1
3: 16
4: 145

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161959505 Original CRISPR CGCTCCCCGGGAGCGCCTGG CGG Exonic
900368063 1:2319547-2319569 GGAGCCCCGTGAGCGCCTGGCGG - Intergenic
900600813 1:3501984-3502006 CACTCACCAGGAGCCCCTGGGGG - Intronic
901700768 1:11043895-11043917 CCCGCCCCGGCAGAGCCTGGTGG - Intronic
904359533 1:29962931-29962953 CCCTTCCTGGGAGCGGCTGGTGG - Intergenic
904359604 1:29963148-29963170 CCCTCCCTGGGAGAGGCTGGAGG - Intergenic
904359637 1:29963241-29963263 CCCTCCCTGGGAGTGGCTGGAGG - Intergenic
904359648 1:29963272-29963294 CCCTCCCTGGGAGTGGCTGGAGG - Intergenic
904359659 1:29963303-29963325 CCCTCCCTGGGAGTGGCTGGAGG - Intergenic
904359670 1:29963334-29963356 CCCTCCCTGGGAGTGGCTGGAGG - Intergenic
904359692 1:29963396-29963418 CCCTCCCTGGGAGTGGCTGGAGG - Intergenic
906315935 1:44786434-44786456 CGCCCGCCGGGAGCCTCTGGGGG - Intronic
910759240 1:90718645-90718667 TCCTCCCCGAGAGCGCCTGGTGG - Intergenic
915635885 1:157186303-157186325 AGCTCTCCGGCAGCTCCTGGAGG - Intergenic
915980312 1:160416131-160416153 GGCTCCCGGGGAGCCCCTGCTGG + Exonic
919615525 1:199803767-199803789 CTCTCCCCCTGAGTGCCTGGAGG - Intergenic
922739298 1:228006661-228006683 CGCGGCCCGGGAGCTCCAGGAGG + Intergenic
1063127179 10:3145555-3145577 GGCGCCCGGTGAGCGCCTGGTGG - Intronic
1068866794 10:61903246-61903268 CCCTCCCCGGGAGCGCCGTCTGG - Intronic
1068866799 10:61903254-61903276 CGCTCCCGGGGAGGGCGGGGAGG + Intronic
1070329135 10:75405495-75405517 CGCTCCCAGGGACCGCGAGGCGG - Intergenic
1070812514 10:79305539-79305561 CGCTCTGCTGGAGGGCCTGGAGG + Exonic
1070895775 10:79982131-79982153 GGCTCTCCGGGCGCGCCTGGCGG + Intronic
1075616078 10:123891692-123891714 CGGTCACCGGGGGCGCCGGGCGG + Exonic
1076698464 10:132258097-132258119 TGCTCCCGGGGAGGTCCTGGGGG - Intronic
1080521010 11:33067814-33067836 GGCACCCTGGGAGAGCCTGGGGG + Intronic
1081672842 11:44951031-44951053 CGGCCCCCGGGAGAGCCTCGCGG - Intronic
1081981433 11:47269620-47269642 CACTCCCCGCGCGCGCCCGGTGG + Intronic
1084030945 11:66480272-66480294 CGCCACCCCGTAGCGCCTGGGGG + Exonic
1084642990 11:70437022-70437044 AGCTCCCTGGGAGCACCTGATGG - Intergenic
1084681381 11:70668455-70668477 CTCTCCCCTGGAGCCCCCGGAGG + Intronic
1090807908 11:130213849-130213871 CCCTCCCCAGGAGCACCTGAGGG + Intergenic
1091915420 12:4269491-4269513 CCCCTCCCGGGGGCGCCTGGAGG + Intergenic
1092111540 12:5968156-5968178 CTCTCCCCCAGAGCGCATGGAGG - Exonic
1092204371 12:6606624-6606646 CGCTCCGTGGGGGCGCCTGCCGG - Intronic
1093094943 12:14961226-14961248 CACGCACCGGGAGTGCCTGGAGG - Intronic
1095687479 12:45051503-45051525 CGCTGGCCTGGAGCGCCCGGAGG + Intergenic
1096482614 12:51952218-51952240 CGCCCCCCAGGAGCACCTGGAGG - Intronic
1097088788 12:56488629-56488651 CGCTCCCCGGGAACACCGTGGGG + Intergenic
1106246554 13:27954608-27954630 CGCTCCCAGCGGGCGCCCGGGGG - Intergenic
1107555314 13:41512708-41512730 CGCTGCCTGGGAGCCCCTGGTGG + Intergenic
1110572969 13:77026676-77026698 CGCTCCTCAGGAGTGCCGGGCGG - Intronic
1111934986 13:94549163-94549185 CGCTCACCGGCAACGCCAGGTGG + Intergenic
1115852225 14:37597763-37597785 TGCTCCCCGGAGGCGCCTGCGGG - Intronic
1117392055 14:55271630-55271652 CGCGCCCCGGGAGCGCAGGCAGG - Intronic
1121522371 14:94594823-94594845 CGTTCCATGGGAGGGCCTGGTGG - Intronic
1121693131 14:95892156-95892178 CGCTGCCAGGGGGCCCCTGGTGG + Intergenic
1122875242 14:104660862-104660884 AGCTCCCCGGGGGGGCCAGGAGG + Intergenic
1122920935 14:104879858-104879880 AGCTCCCCGGGAGCCCTTTGGGG + Intronic
1125619248 15:41045001-41045023 CGCTCCTGGGGAGCGCCAGAAGG - Exonic
1125731144 15:41893458-41893480 CAGTCCCCGGGAGCTCCTCGGGG - Exonic
1127415128 15:58749909-58749931 CGCGCCCCTGAAGCGCCTGGGGG - Exonic
1128247718 15:66144310-66144332 TGCTCTCAGGGAGCTCCTGGTGG - Intronic
1132869143 16:2107954-2107976 CATTCCACGGGAGCGGCTGGCGG - Exonic
1136564328 16:31061103-31061125 CACACCCCTGGAGCCCCTGGTGG - Exonic
1136685257 16:31990271-31990293 GGGTCCCAGGGAGGGCCTGGTGG + Intergenic
1136785870 16:32933806-32933828 GGGTCCCAGGGAGGGCCTGGTGG + Intergenic
1136883901 16:33919998-33920020 GGGTCCCAGGGAGGGCCTGGTGG - Intergenic
1142233417 16:88910378-88910400 TGCTCCCCGTGAGCTCCAGGAGG + Intronic
1142278789 16:89137297-89137319 CCTTCCCCGTGAGCTCCTGGTGG - Intronic
1142278807 16:89137352-89137374 CCTTCCCCGTGAGCTCCTGGTGG - Intronic
1142278826 16:89137407-89137429 CCTTCCCCGTGAGCTCCTGGTGG - Intronic
1142278843 16:89137462-89137484 CTTTCCCCGTGAGCTCCTGGTGG - Intronic
1142278859 16:89137517-89137539 CTTTCCCCGTGAGCTCCTGGTGG - Intronic
1142278894 16:89137627-89137649 CCTTCCCCGTGAGCTCCTGGTGG - Intronic
1142324088 16:89402867-89402889 CTTCCCCCGGGAGAGCCTGGAGG - Intronic
1203088107 16_KI270728v1_random:1195468-1195490 GGGTCCCAGGGAGGGCCTGGTGG + Intergenic
1142696251 17:1635382-1635404 CGCCCCCCGGGAGAGCCTCTTGG + Exonic
1143167134 17:4902367-4902389 CCCTCCCAGGCAGCGCCAGGTGG - Exonic
1143487444 17:7262530-7262552 CGCGCCCCGGGAGCGCGGGAGGG + Intronic
1144788264 17:17843806-17843828 CCCTCTCCGGGAGAGCCTGGAGG + Intronic
1146183261 17:30710034-30710056 CGCGCCCCGGGAGCTCCGTGGGG - Intergenic
1147146202 17:38485952-38485974 AGGTCCCAGGGAGGGCCTGGTGG + Intronic
1147334562 17:39719562-39719584 CGCTCCCCTGCAGCTCCTTGTGG - Intronic
1147811245 17:43171272-43171294 CGCCCCCGGGGGGCGCCTGCCGG - Intronic
1147879760 17:43646105-43646127 TGCTCCCCGGGCGCGCCCCGCGG - Intronic
1151785106 17:76271613-76271635 TGCTTCCTGGGAGGGCCTGGGGG - Intergenic
1152581974 17:81169613-81169635 CCCTCCCCTGGAGCATCTGGAGG - Intergenic
1153040790 18:811944-811966 CCCTCCCCCGGATCGCCCGGCGG - Intronic
1153685938 18:7545407-7545429 CTCTCCCCTAGAGCCCCTGGAGG - Intergenic
1156325007 18:36067187-36067209 GGGTTCCCGGGGGCGCCTGGAGG + Intronic
1160754040 19:748462-748484 CGCTCACCCTGAGCGCCTTGGGG + Intergenic
1160788628 19:912831-912853 CGAGCCCCCGGAGCGCCAGGAGG + Intronic
1160965911 19:1746826-1746848 CGCTCCCTGGGATCGCCCGAAGG + Intergenic
1160970747 19:1766743-1766765 CACTGCCCTGGAGCGCCGGGTGG - Intronic
1160972420 19:1775534-1775556 CGCCCCCAGGGGGCACCTGGAGG + Exonic
1161203918 19:3030357-3030379 CACTCCCCGGGTGGGCCTGAAGG - Intronic
1161628420 19:5339770-5339792 CACGCCCCGGGAGCCCCCGGGGG - Intronic
1161959505 19:7516109-7516131 CGCTCCCCGGGAGCGCCTGGCGG + Exonic
1162013277 19:7830577-7830599 CCCTCCCCAGGAGCTCCTGCAGG + Intronic
1162824932 19:13245439-13245461 CCCTCCCTGGGAACTCCTGGGGG + Intronic
1163370392 19:16897937-16897959 TGCTCTCCGGGAGTGCGTGGTGG - Exonic
1166762609 19:45234443-45234465 CGCGGCCCGGGAGCGCCTAGAGG - Intronic
1167056219 19:47112845-47112867 CGCCCCCCGGGGGTGCGTGGGGG - Intronic
1167752549 19:51389391-51389413 CGCTCTCCGGGAGCCCCAGGTGG + Exonic
1167810840 19:51828878-51828900 GGCTCCCCTGCAGCTCCTGGAGG + Intergenic
926012960 2:9423192-9423214 CGCTCCCGGGGCGCGGGTGGAGG - Exonic
927931845 2:27050467-27050489 CGCTGCCCCGGAGCTCCAGGAGG + Intronic
928371764 2:30745019-30745041 GGCTCCCCTGGAAGGCCTGGAGG + Intronic
932823360 2:74920023-74920045 CGTCCCCCGGGAGCGGGTGGCGG + Intergenic
935645361 2:105329745-105329767 CGCCCTCCGCCAGCGCCTGGCGG - Exonic
1171091846 20:22292858-22292880 TGCTCCCCGGGAGTCCCAGGAGG + Intergenic
1172303617 20:33866230-33866252 CTCTCCCCCGGAGCGTCTGCAGG - Intergenic
1173800196 20:45890511-45890533 CATTCCCCGGGACCGCCTGGTGG - Exonic
1174166342 20:48586221-48586243 CTGTGCCCGGGAGCGCCTGGTGG - Intergenic
1176173585 20:63707531-63707553 CGCTCCCCAGGAGCCCCTGCAGG + Intronic
1179990098 21:44943545-44943567 CTCTGCCCGGGAGGACCTGGGGG - Intronic
1180099357 21:45577250-45577272 CCCACCCTGGGAGTGCCTGGGGG - Intergenic
1180180716 21:46117625-46117647 CTCCCCCTGGGAGCTCCTGGCGG + Intronic
1180950553 22:19718752-19718774 AGCGCCCCAGGACCGCCTGGTGG + Intronic
1184263933 22:43336533-43336555 AGCTCACTGGGAGCTCCTGGGGG + Intronic
1184759626 22:46537236-46537258 CGCTCCCCGGCCTCGCCGGGTGG - Intergenic
1185334663 22:50266159-50266181 CTCTCCCCCAGAGAGCCTGGGGG + Intronic
1185340813 22:50290254-50290276 CCCTCCCAGGAAGCGCCTGGTGG - Exonic
1185387815 22:50544360-50544382 CGCCCCCGGGCCGCGCCTGGAGG - Intergenic
952942348 3:38454255-38454277 CGCGCCCCGGGAGCGCCGTGCGG + Exonic
953443065 3:42936440-42936462 CGCTCACCGTGGGCTCCTGGCGG - Intronic
961536127 3:127572142-127572164 GGCTCCCTGGGAGGGCCTGGAGG - Intergenic
968405538 4:336870-336892 CGGTTCCCAGGAGCTCCTGGGGG - Intergenic
968580034 4:1385523-1385545 CGCTCCCCGGGAGGCCAAGGGGG + Intronic
978515001 4:109560257-109560279 GGCTCCTCGTCAGCGCCTGGTGG - Exonic
978529953 4:109703109-109703131 CGCTACTCGGGACCGCCAGGAGG + Intronic
978846099 4:113274574-113274596 CTCTGCCCGGGAGGGCCAGGTGG + Exonic
990954796 5:61331534-61331556 AGCTCCCCTGGACCGGCTGGAGG + Intergenic
992052855 5:72956520-72956542 CGCTGGCTGGGAGCGCCGGGCGG + Intronic
996398565 5:123036311-123036333 CGCTCCGGGGGAGACCCTGGGGG - Intronic
999790778 5:154937903-154937925 CGCTCCCCAGGGGCGCCGAGTGG - Intronic
1002594604 5:180313764-180313786 CCGTCCCAGGGAGAGCCTGGCGG - Intronic
1006094548 6:31647691-31647713 ACCTCCCCGGGAGCCCATGGAGG - Exonic
1006139084 6:31916615-31916637 CTCTCCTCAGGAGGGCCTGGGGG - Intronic
1007595488 6:43048519-43048541 CACTCCCCTGCAGCGTCTGGTGG - Exonic
1013480681 6:110550394-110550416 CCCTTCCCGGGAGAGCCAGGTGG + Intergenic
1013980358 6:116121343-116121365 CGTTCCCCAGGAGGGCCTTGGGG + Exonic
1014001728 6:116371729-116371751 CCCTCCCCGGGACTGCCTCGGGG - Intronic
1014724921 6:124962474-124962496 CGCTGCCCGCGGGCGCCGGGTGG + Intergenic
1015315069 6:131808089-131808111 CGCTCCCCGGGAGGGCCCGGCGG + Exonic
1016014245 6:139167215-139167237 CGAACACCGGGAGCGCCCGGTGG - Exonic
1016035032 6:139375419-139375441 CGTACCCCGGGAGCGGCAGGCGG - Intergenic
1018723390 6:166591206-166591228 CCCTCCACGGGAGGCCCTGGGGG + Intronic
1019197311 6:170290147-170290169 CGCTCCACGCGCGAGCCTGGGGG + Exonic
1019400037 7:847424-847446 CCCTCTCCGGGATCCCCTGGGGG + Intronic
1019400275 7:848106-848128 CCCTCTCCGGGATCCCCTGGGGG + Intronic
1019400298 7:848178-848200 CCCTCTCCGGGATCCCCTGGGGG + Intronic
1019429758 7:993244-993266 CGTTCCCTGGGAGCCACTGGAGG + Intergenic
1020277787 7:6635467-6635489 CCCTTCCTGGGAGTGCCTGGGGG + Intergenic
1021450367 7:20778381-20778403 CCCTCCCCGGGAGGGCCCCGGGG + Intergenic
1023965968 7:44963215-44963237 CGCTCCCCGGGTGCGGTTGGGGG - Intronic
1024249351 7:47494731-47494753 CGCCTCCCGGGAGCAGCTGGCGG - Intronic
1024965643 7:55020063-55020085 CCCTCCCCGGGAGCCGCAGGTGG - Intronic
1028796353 7:94907928-94907950 CGCGGGCAGGGAGCGCCTGGGGG + Intronic
1029525012 7:101088860-101088882 CGGTCCCCGGGAGATCCTGGTGG + Exonic
1029735845 7:102465318-102465340 CGCTCGCCGGGAGCCCCGAGGGG + Intronic
1029849220 7:103445611-103445633 TGCTCCCTGGGAGCTCCGGGCGG + Intronic
1032057813 7:128697643-128697665 CGCAGCCCGGGACCTCCTGGTGG + Intergenic
1035528429 8:332841-332863 TGCTCCCTGGGAGTCCCTGGAGG + Intergenic
1039912299 8:41834936-41834958 CGCTGCCCGGGAGAAGCTGGAGG + Intronic
1049312249 8:141939319-141939341 CACTCACCGGGAGAGGCTGGAGG + Intergenic
1049442589 8:142616093-142616115 GGCTCCCCGGGAGAGCCGGTTGG - Intergenic
1052756779 9:32550549-32550571 CGCCCCTCGGGAGCGCTTGTGGG + Intronic
1060984059 9:127809799-127809821 CGCGGCCCTGCAGCGCCTGGCGG - Exonic
1061777125 9:132973083-132973105 GGCTCTCTGGGAGCCCCTGGAGG + Intronic
1062082231 9:134630174-134630196 TGCTCCCCTGGAGCCTCTGGGGG - Intergenic
1062445534 9:136592597-136592619 CCCTCCCCTGGAGCCTCTGGAGG + Intergenic
1062450716 9:136614638-136614660 CACAGCCTGGGAGCGCCTGGAGG - Intergenic