ID: 1161961207

View in Genome Browser
Species Human (GRCh38)
Location 19:7524219-7524241
Sequence CAGACCTGCCACTTTACAGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 130
Summary {0: 1, 1: 0, 2: 2, 3: 10, 4: 117}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161961207_1161961212 9 Left 1161961207 19:7524219-7524241 CCTACTGTAAAGTGGCAGGTCTG 0: 1
1: 0
2: 2
3: 10
4: 117
Right 1161961212 19:7524251-7524273 GCTAGGGCTGCATGATTTCTAGG 0: 1
1: 0
2: 0
3: 10
4: 133
1161961207_1161961211 -7 Left 1161961207 19:7524219-7524241 CCTACTGTAAAGTGGCAGGTCTG 0: 1
1: 0
2: 2
3: 10
4: 117
Right 1161961211 19:7524235-7524257 AGGTCTGGGATTTGATGCTAGGG 0: 1
1: 0
2: 3
3: 14
4: 186
1161961207_1161961215 27 Left 1161961207 19:7524219-7524241 CCTACTGTAAAGTGGCAGGTCTG 0: 1
1: 0
2: 2
3: 10
4: 117
Right 1161961215 19:7524269-7524291 CTAGGAGCTGGTGCTTTTCAGGG 0: 1
1: 0
2: 1
3: 21
4: 277
1161961207_1161961213 15 Left 1161961207 19:7524219-7524241 CCTACTGTAAAGTGGCAGGTCTG 0: 1
1: 0
2: 2
3: 10
4: 117
Right 1161961213 19:7524257-7524279 GCTGCATGATTTCTAGGAGCTGG 0: 1
1: 0
2: 1
3: 9
4: 111
1161961207_1161961210 -8 Left 1161961207 19:7524219-7524241 CCTACTGTAAAGTGGCAGGTCTG 0: 1
1: 0
2: 2
3: 10
4: 117
Right 1161961210 19:7524234-7524256 CAGGTCTGGGATTTGATGCTAGG 0: 1
1: 1
2: 1
3: 29
4: 342
1161961207_1161961214 26 Left 1161961207 19:7524219-7524241 CCTACTGTAAAGTGGCAGGTCTG 0: 1
1: 0
2: 2
3: 10
4: 117
Right 1161961214 19:7524268-7524290 TCTAGGAGCTGGTGCTTTTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161961207 Original CRISPR CAGACCTGCCACTTTACAGT AGG (reversed) Intronic
902960755 1:19961538-19961560 CAGACCTGCCACTGCCCTGTGGG - Intergenic
903130731 1:21278001-21278023 CAGACCAGCAACTTCACAGAGGG + Intronic
904026069 1:27504584-27504606 GAGACCTGAGGCTTTACAGTGGG + Intergenic
907157059 1:52344213-52344235 CAGCCCTGCCACTATAGAGGCGG - Intronic
908144882 1:61230311-61230333 CAGAACACCCACTTCACAGTAGG - Intronic
920743106 1:208599937-208599959 CAGACCAGCCACATTGCCGTTGG - Intergenic
921127523 1:212190464-212190486 CAGGGCTGCCACTTCACACTTGG - Intergenic
921824180 1:219653280-219653302 GAGACCTGAGCCTTTACAGTTGG - Intergenic
923304796 1:232678595-232678617 TAAACTTCCCACTTTACAGTGGG - Intergenic
1064774558 10:18761254-18761276 CAGAACTGTTATTTTACAGTGGG + Intergenic
1070481695 10:76889363-76889385 CAGACCTTTGCCTTTACAGTAGG + Intronic
1074855732 10:117472062-117472084 CTCACCTTCCACTTTACACTTGG - Intergenic
1075647559 10:124106526-124106548 CAAGCCTGCCACTTTCCACTGGG + Intergenic
1076249351 10:128972929-128972951 CAGACCTGCCAGTTCACAGTAGG - Intergenic
1077854614 11:6110616-6110638 CAGTACTGCCACTTCCCAGTGGG - Intergenic
1080174070 11:29340867-29340889 CAGTCCTGCCACATTCAAGTAGG - Intergenic
1083317103 11:61822555-61822577 CAGACCTGCCTCTATTAAGTGGG + Intronic
1083713775 11:64564289-64564311 CACACCTGCCTCCTTACAGGTGG + Exonic
1086303675 11:85457613-85457635 CAGACTTGCTGCTTTACAATAGG - Intronic
1091097926 11:132841410-132841432 CAGGCCTGGCCCTCTACAGTGGG - Intronic
1093130867 12:15390506-15390528 AAGACCTGCCACCTCCCAGTGGG + Intronic
1094435681 12:30418598-30418620 CCAACGTGTCACTTTACAGTTGG + Intergenic
1102619794 12:114185008-114185030 CACACCTGCCACTTTCTGGTTGG - Intergenic
1102716328 12:114976198-114976220 CAATCCTCCCACTTTACAGATGG + Intergenic
1102883604 12:116505376-116505398 CAAACCTGCTTCTTTACAGCAGG - Intergenic
1104329835 12:127834092-127834114 CATACCTGCCACGTTACGGCAGG + Intergenic
1104639260 12:130457065-130457087 CAGCCCGGGCACTTTGCAGTTGG + Intronic
1112208924 13:97353906-97353928 CAGAGCTACCACTTTAAAGTAGG - Intronic
1112400934 13:99077770-99077792 CAGACCTGCCACATTCAAGATGG + Intronic
1112657163 13:101463303-101463325 CAGCCCTGGCACTATAGAGTAGG - Intronic
1113787607 13:113010712-113010734 CAGACCTGCCTCTGAGCAGTGGG + Intronic
1121031335 14:90661055-90661077 CAGCCCTGCCCCTTCACAGCCGG + Intronic
1121514207 14:94538484-94538506 CAGGCCTGCCACCTTCCACTGGG - Intergenic
1121993248 14:98581888-98581910 CATCCCTGCCACTTCACAGGTGG - Intergenic
1122178443 14:99937681-99937703 GAGACCTTCCACTTCCCAGTCGG - Intronic
1122404145 14:101489564-101489586 CTGACCTTCCTCTTTACACTGGG - Intergenic
1122660371 14:103290837-103290859 CTGACCAGCCACTGTCCAGTGGG + Intergenic
1125101479 15:35917992-35918014 CAGACCTGACACTAGACACTGGG - Intergenic
1125763979 15:42120722-42120744 CAGAGCTGCTGCTATACAGTGGG - Intergenic
1129333928 15:74841400-74841422 CAGACCTGCCAGTTTTAGGTGGG + Exonic
1129604377 15:77017682-77017704 CAGGCCAGCCACTTTCCAGCTGG + Intronic
1129712319 15:77826640-77826662 CTGACCTGCCACTTATCAGCTGG - Intergenic
1131364749 15:91828848-91828870 CAACCCTACCACTTTACAGAGGG + Intergenic
1132421680 15:101675231-101675253 CAGCCCTGGGACTCTACAGTCGG + Intronic
1133224220 16:4332952-4332974 CGAACCTGCCACTTTACAGAAGG + Intronic
1133330880 16:4973156-4973178 CAGCTCTGCCACTTGACAGCTGG - Intronic
1136062047 16:27733239-27733261 GAGACCTGCCATTCTACACTGGG + Intronic
1137396763 16:48121504-48121526 CAGACCTGCGACTGCACACTGGG - Intronic
1138774226 16:59702138-59702160 CAGACTTTCCAATTTACGGTGGG + Intergenic
1141888855 16:86912960-86912982 CAGACCTGCCCCATGCCAGTAGG + Intergenic
1145213511 17:21034219-21034241 CAGACCTTTCAATTTACAGAAGG + Intronic
1147669743 17:42170077-42170099 CAGACCTGCCACGCCTCAGTGGG - Intronic
1148133437 17:45276197-45276219 CGGACCTGCCATTTGGCAGTGGG - Intronic
1149362405 17:55909964-55909986 GAGTCCTGCCACTGTGCAGTCGG + Intergenic
1150072687 17:62165457-62165479 CACACCTGGCCCTTTCCAGTGGG + Intergenic
1150967822 17:69991617-69991639 CAGACCTTCCCCTTTGCAGGAGG - Intergenic
1151059842 17:71079320-71079342 GAGACTTGCAATTTTACAGTAGG + Intergenic
1157804177 18:50645804-50645826 CAGTTCTGCCACTTTCCAGATGG + Intronic
1158304003 18:56084510-56084532 ATGACCTGCCATTTCACAGTGGG + Intergenic
1158932956 18:62338974-62338996 CAGAGTTGCCACTTTGCTGTCGG + Intronic
1160209740 18:76866892-76866914 AAGACCTGCCAGCTTACAGACGG - Intronic
1161729595 19:5951321-5951343 CAGACCAGCCACTTTCCCTTCGG - Intronic
1161961207 19:7524219-7524241 CAGACCTGCCACTTTACAGTAGG - Intronic
1162843379 19:13372546-13372568 CAGATCTGCCACTTTCCAGTTGG + Intronic
1164182203 19:22829245-22829267 CAGTTCTGCTATTTTACAGTAGG + Intergenic
1166548504 19:43649209-43649231 GTGACCTGCCACCTTGCAGTGGG + Intronic
1168538420 19:57191258-57191280 CAGACCCACCTCTTTACGGTGGG - Intergenic
933939673 2:87234898-87234920 CAGAACACCCACTTTACAGATGG + Intergenic
936353464 2:111730875-111730897 CAGAACACCCACTTTACAGATGG - Intergenic
940882863 2:158964306-158964328 AAGACCTGCCAATTTACCCTCGG + Intergenic
941731559 2:168923353-168923375 CTGAGCTGCCACTTGACATTGGG + Exonic
1173439768 20:43065853-43065875 CAGACCTCTCATTTTACAGTTGG + Intronic
1173912107 20:46678077-46678099 CAAATCTTCCACTTTACAGGTGG + Intronic
1174846332 20:53947120-53947142 CAGACCTGCCACTTCCTAGCTGG + Intronic
1175263145 20:57687339-57687361 CAGCCCTGCCATTTAACAGAGGG + Intronic
1178150762 21:29790986-29791008 CAGACCACCCAATTTAAAGTTGG - Intronic
1182134463 22:27888306-27888328 TACACCTGTCACTTTACAGTGGG + Intronic
1184042719 22:41953466-41953488 TAGCTCTGCCACTTTCCAGTTGG + Intergenic
953771341 3:45780464-45780486 CAGTTCTGCCACTTAACAGCCGG - Intronic
960703858 3:120463031-120463053 GAGACCTGCCACTTACTAGTTGG + Intergenic
961518566 3:127454043-127454065 CAGACTTGCCACTTTCCAGCTGG - Intergenic
962277543 3:134027685-134027707 TAGCCCTGCCACTTTGCAGTGGG - Intronic
963642856 3:147880217-147880239 CAGTCCTGCCACATTACATGGGG + Intergenic
964864589 3:161242398-161242420 TTGACCTGCCACTTCCCAGTTGG + Intronic
967316365 3:188154611-188154633 AAGTCCTCCCATTTTACAGTTGG + Intronic
969178897 4:5422303-5422325 CAAACCTGCCACTTGGCATTAGG - Intronic
970356388 4:15257525-15257547 CAGCTCAGCCACTTAACAGTGGG + Intergenic
977002297 4:91519196-91519218 CAGTCCTGCCACTTTTCCATAGG + Intronic
978235667 4:106455720-106455742 GAGAGCTGCCACTTTTCAGCGGG + Intergenic
978427663 4:108598750-108598772 CAGCTCTGCCACTTAACAGAGGG + Intergenic
980203021 4:129679748-129679770 CAGTTCTGCCACTTAAAAGTTGG - Intergenic
982604186 4:157492965-157492987 CAGGACTTCCACTTTCCAGTAGG + Intergenic
983899052 4:173113534-173113556 CAGTCTGGCCACTTTACTGTAGG - Intergenic
984025706 4:174540429-174540451 CAGACTTGCCTCTTTGCAGTAGG + Intergenic
985630417 5:1011043-1011065 TAGACCTGCCACTCTACACTGGG + Intronic
985845155 5:2339083-2339105 CAACCCTGCCACTTCACAGATGG + Intergenic
992788692 5:80194398-80194420 AAGACCTGTCATTTTACATTGGG + Intronic
993150137 5:84151417-84151439 AAGACCTGCCTCTTTTCATTTGG - Intronic
993383737 5:87238811-87238833 CAGACCTGGCCCTTTGCAGGTGG - Intergenic
994110749 5:96001096-96001118 ATGATCTGCCACTTTACACTGGG - Intergenic
994346695 5:98696312-98696334 CAGTCTGGCCACTTTTCAGTAGG + Intergenic
994817666 5:104604843-104604865 CAGACCTGCCAGTTCCCAGCTGG + Intergenic
996901928 5:128552346-128552368 CAGTCTGGCCACTTTTCAGTGGG - Intronic
999428705 5:151508058-151508080 CAGATCAGCCACCTTACAATGGG + Intronic
1002594181 5:180311622-180311644 CAGAGCTGCCACTGGACAGCTGG - Intronic
1004540624 6:16546374-16546396 CAGCCCTGCCTCATCACAGTTGG - Intronic
1008257580 6:49322980-49323002 CAGACCTTCCACTTCAAAGTGGG + Intergenic
1010949939 6:82023609-82023631 CACACCTGCTACTTCACAGTGGG + Intergenic
1013617357 6:111857574-111857596 CAAACCTGCCACTCTGCATTTGG - Intronic
1013745640 6:113342823-113342845 CAAATCTGCCCCTTCACAGTTGG + Intergenic
1016782848 6:147979063-147979085 CAGAAATGCCACTTTGGAGTGGG + Intergenic
1020342617 7:7128711-7128733 CAAACCTGTCATTTTACAGCTGG - Intergenic
1022370463 7:29766159-29766181 CAGTCCTGCCACTTATCAGCTGG - Intergenic
1022813830 7:33895013-33895035 TTGACCTACCAGTTTACAGTGGG + Intergenic
1023190107 7:37570999-37571021 CAGCCCTGCCAGTTTGCAGGAGG - Intergenic
1032737084 7:134702419-134702441 CACACCTGCAACTTCAGAGTTGG + Intergenic
1036286574 8:7448487-7448509 CAATCCTGTCACTTTACAGATGG + Intronic
1036334903 8:7863037-7863059 CAATCCTGTCACTTTACAGATGG - Intronic
1037215145 8:16441504-16441526 CAGACCTACCGCATTTCAGTGGG - Intronic
1043174074 8:77001360-77001382 CAGACTAGCCACTTTTCAGGTGG - Intergenic
1047702484 8:127463451-127463473 CATCCCTTCCACTGTACAGTCGG + Intergenic
1053341429 9:37337538-37337560 CAGAGCTGCCAGTTTCCAGGCGG + Intronic
1054762885 9:69019158-69019180 CACACCTGCCAATTAACAGAAGG + Intergenic
1055591933 9:77825643-77825665 CAGACTTCTCACTTTACACTTGG - Intronic
1057260096 9:93578113-93578135 CAGTCCTGCCAGTTTACATGTGG + Intronic
1057963684 9:99481739-99481761 CAGACCTGACTGTTTACACTTGG - Intergenic
1059399529 9:114060224-114060246 CAGACCGGCCAGTTGTCAGTTGG + Exonic
1060673128 9:125488196-125488218 CAGACATGCCCCTTGTCAGTTGG - Intronic
1189320467 X:40084121-40084143 CACCCCTCCCACGTTACAGTAGG - Intronic
1200949196 Y:8877465-8877487 CATACCTGGCCCTTTACAGAAGG - Intergenic