ID: 1161961811

View in Genome Browser
Species Human (GRCh38)
Location 19:7527527-7527549
Sequence GCCGCTCGGGGGGATCCACC TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 60
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 55}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161961811_1161961827 13 Left 1161961811 19:7527527-7527549 CCAGGTGGATCCCCCCGAGCGGC 0: 1
1: 0
2: 0
3: 4
4: 55
Right 1161961827 19:7527563-7527585 CAGCGACGATCTCACCCTCTTGG 0: 1
1: 0
2: 0
3: 0
4: 61

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161961811 Original CRISPR GCCGCTCGGGGGGATCCACC TGG (reversed) Exonic