ID: 1161963755

View in Genome Browser
Species Human (GRCh38)
Location 19:7536361-7536383
Sequence CTTCCTTGATGGAGACCCCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 162
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 154}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161963746_1161963755 16 Left 1161963746 19:7536322-7536344 CCCTTCCCTATTTACACTTCTTA 0: 1
1: 1
2: 1
3: 31
4: 322
Right 1161963755 19:7536361-7536383 CTTCCTTGATGGAGACCCCCTGG 0: 1
1: 0
2: 0
3: 7
4: 154
1161963749_1161963755 10 Left 1161963749 19:7536328-7536350 CCTATTTACACTTCTTAGTGTCC 0: 1
1: 0
2: 0
3: 15
4: 136
Right 1161963755 19:7536361-7536383 CTTCCTTGATGGAGACCCCCTGG 0: 1
1: 0
2: 0
3: 7
4: 154
1161963744_1161963755 22 Left 1161963744 19:7536316-7536338 CCGCGCCCCTTCCCTATTTACAC 0: 1
1: 0
2: 0
3: 19
4: 172
Right 1161963755 19:7536361-7536383 CTTCCTTGATGGAGACCCCCTGG 0: 1
1: 0
2: 0
3: 7
4: 154
1161963745_1161963755 17 Left 1161963745 19:7536321-7536343 CCCCTTCCCTATTTACACTTCTT 0: 1
1: 0
2: 1
3: 43
4: 462
Right 1161963755 19:7536361-7536383 CTTCCTTGATGGAGACCCCCTGG 0: 1
1: 0
2: 0
3: 7
4: 154
1161963748_1161963755 11 Left 1161963748 19:7536327-7536349 CCCTATTTACACTTCTTAGTGTC 0: 1
1: 0
2: 1
3: 12
4: 184
Right 1161963755 19:7536361-7536383 CTTCCTTGATGGAGACCCCCTGG 0: 1
1: 0
2: 0
3: 7
4: 154
1161963747_1161963755 15 Left 1161963747 19:7536323-7536345 CCTTCCCTATTTACACTTCTTAG 0: 1
1: 0
2: 1
3: 12
4: 185
Right 1161963755 19:7536361-7536383 CTTCCTTGATGGAGACCCCCTGG 0: 1
1: 0
2: 0
3: 7
4: 154

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161963755 Original CRISPR CTTCCTTGATGGAGACCCCC TGG Intronic
900198635 1:1391421-1391443 CTTCCTTGAAGGAGTCCACTTGG + Intronic
900458567 1:2789444-2789466 CTACCTCGAAGGAGACCCGCAGG + Intronic
901959110 1:12810466-12810488 CTCCCTTTCTGGAGTCCCCCTGG + Intergenic
902877361 1:19348982-19349004 CCTGTTTTATGGAGACCCCCTGG - Intronic
903763547 1:25716652-25716674 CTTCCTTTATGGAGCCTCCTGGG + Intronic
904822615 1:33255852-33255874 CGTCTTCGAGGGAGACCCCCAGG + Intergenic
905598774 1:39232511-39232533 CTTCCATGATGGTGTTCCCCAGG + Intronic
905694193 1:39962837-39962859 CATCCTTGAGAGAGGCCCCCAGG - Intronic
906949930 1:50326422-50326444 CCTCCTTGAGAGAGGCCCCCAGG - Intergenic
907040057 1:51251167-51251189 CATCCTTGAGAGAGGCCCCCAGG + Intronic
907959529 1:59265675-59265697 CTTCCTTGGCAGAGTCCCCCAGG + Intergenic
907963654 1:59307984-59308006 CTCCCTTCCTGGAGACCCCCTGG - Intronic
910428799 1:87141095-87141117 CTTCCTTGGTGCACAGCCCCAGG + Intronic
912804412 1:112744062-112744084 CTTCCTTCGTGGAGTCGCCCGGG - Intergenic
913991017 1:143611815-143611837 CTTCATTGGTGGTGACCCTCAGG - Intergenic
916102695 1:161406496-161406518 CATCCTTGAGAGAGGCCCCCAGG - Intergenic
917016119 1:170532578-170532600 CTTCCCTAAGGGAGACACCCCGG - Intronic
919548115 1:198949215-198949237 TGTCCTTGAGAGAGACCCCCAGG - Intergenic
921183153 1:212647071-212647093 CTTCTCTGATGGGGTCCCCCAGG - Intergenic
1069778012 10:70938016-70938038 CTTCCTTGAGGGAGGAGCCCTGG - Intergenic
1069914548 10:71779425-71779447 CATCATGGATGGAGACCCTCTGG + Intronic
1070248450 10:74753176-74753198 CTTCCTTCATTCACACCCCCCGG + Intergenic
1072472999 10:95731680-95731702 CTGTCTTGATAGGGACCCCCTGG - Intronic
1073083203 10:100872749-100872771 CCTGCTGGCTGGAGACCCCCAGG + Intergenic
1073593653 10:104779535-104779557 CTTCCTCCGTGGAGTCCCCCTGG - Intronic
1077244360 11:1528915-1528937 CTTCCCTGTTGGAGACCACTGGG + Intergenic
1077539485 11:3139800-3139822 CTTCCCTGCTGGAGTCCCCGAGG + Intronic
1078245103 11:9567021-9567043 TTTCCTAGCTGGAGACCCCAAGG + Intergenic
1080839005 11:35967110-35967132 CTTCCATCATGGTGACCCTCGGG - Intronic
1083299907 11:61734882-61734904 CTTCCTCGATGGTGACTCCAGGG - Exonic
1086944343 11:92830447-92830469 CTTCCTTGATGGAGTATTCCAGG + Intronic
1091358314 11:134955248-134955270 CTTACTTGCTGGAGACCCCATGG + Intergenic
1096100110 12:48965719-48965741 CTCCCTTGAGGGATAACCCCAGG - Exonic
1097596688 12:61642008-61642030 GTTCCTTGATGAAGACTCCAAGG - Intergenic
1102014993 12:109642549-109642571 CCCCCATGATGGAAACCCCCAGG + Intergenic
1103107888 12:118246374-118246396 CATCCTTGAGAGAGGCCCCCAGG - Intronic
1103267253 12:119641061-119641083 CCCCCTATATGGAGACCCCCTGG - Exonic
1118727343 14:68638542-68638564 CTTCCTTGATGGTGAGGCCAGGG - Intronic
1118893215 14:69925775-69925797 CTTGCTGGATGGAGACTACCTGG - Intronic
1119403184 14:74378292-74378314 CGTCCTTGAGAGAGGCCCCCAGG + Intergenic
1119484693 14:74979899-74979921 CTTCCCTGAGGGAGTGCCCCAGG - Intergenic
1121813311 14:96910593-96910615 CTGGCTTCATGGAGACACCCGGG - Intronic
1122912238 14:104836563-104836585 CATCCTTGAGAGAGGCCCCCAGG + Intergenic
1122935799 14:104955528-104955550 CTTGCTTGACGAAGATCCCCTGG + Exonic
1126706080 15:51406353-51406375 CTTCCTGGCTGCAGAGCCCCAGG - Exonic
1126706512 15:51410912-51410934 CTTCCTTCATTGAGGACCCCAGG + Intergenic
1128162343 15:65431883-65431905 CCTCCATCATGGAGACCCCATGG + Intergenic
1128506601 15:68277552-68277574 CTCCCTGGCTGGAGACCCTCAGG + Intergenic
1129141025 15:73598054-73598076 CTTCCTGAATGCAGACCCTCAGG + Intronic
1130907712 15:88252029-88252051 TTTCCTTGGTGGAAAACCCCAGG + Intronic
1132837807 16:1963211-1963233 CATCCTTGAGAGAGGCCCCCAGG + Exonic
1133049015 16:3106336-3106358 CTCCCTTCATTAAGACCCCCAGG + Intergenic
1134110778 16:11514325-11514347 CTTCCCTGGTGGCCACCCCCTGG - Intronic
1134769462 16:16794498-16794520 CTTCCTTGGTGAAGACCACTTGG + Intergenic
1135544685 16:23357761-23357783 CTTCCTTGAGGGCCACCCCATGG + Intronic
1135751975 16:25065498-25065520 CATCCTTGATTGAGGACCCCTGG + Intergenic
1137746559 16:50824731-50824753 CTGCATTGATGAAGCCCCCCAGG + Intergenic
1141428620 16:83959372-83959394 GGTCCAGGATGGAGACCCCCGGG - Exonic
1143020923 17:3916841-3916863 CTTGCTCGCTGCAGACCCCCAGG - Intergenic
1143852955 17:9826231-9826253 CTTGCTTGATGGAAACCAGCAGG - Exonic
1144579665 17:16451244-16451266 CCTCCTTGTTGGAGACCCAGTGG - Intronic
1144812709 17:18010914-18010936 CATCCTTGAGAGAGGCCCCCAGG - Intronic
1145022972 17:19446539-19446561 CATCCTTGAGAGAGGCCCCCAGG + Intergenic
1146206077 17:30906552-30906574 CCTCCTTCGTGGAGACTCCCTGG + Exonic
1146888142 17:36486089-36486111 CTTCCGGGCTGGGGACCCCCCGG - Intergenic
1146899664 17:36575028-36575050 CGTCCTTGAGAGAGGCCCCCAGG + Intronic
1149267907 17:54947757-54947779 TTTTCTTGTTGGAGACCCCAGGG + Intronic
1150310172 17:64121854-64121876 TTTCCTTGATGGAGACTCTCAGG + Intronic
1151881986 17:76901425-76901447 CTTCCTGGAGAAAGACCCCCAGG + Intronic
1153884250 18:9448846-9448868 CATCCTTGGGGGAGACCCCAGGG - Intergenic
1154075669 18:11198534-11198556 CTTCATTCAGGGAGACCACCAGG + Intergenic
1154496626 18:14965991-14966013 CTTACTTGCTGGAGATCCCATGG - Intergenic
1155167073 18:23240173-23240195 CTTCCTTGAGGCCTACCCCCTGG - Intronic
1159601234 18:70430530-70430552 CGTCCTTGAGAGAGGCCCCCAGG - Intergenic
1160696248 19:485982-486004 CTTCCTTGTTAGAGTCTCCCGGG - Intergenic
1161963755 19:7536361-7536383 CTTCCTTGATGGAGACCCCCTGG + Intronic
1162673991 19:12284597-12284619 CGTCCTTGAGAGAGGCCCCCAGG - Intronic
1162919244 19:13890384-13890406 CCTCCTGGAGGGGGACCCCCAGG + Exonic
1163295968 19:16412985-16413007 CATCCTTGAGAGAGCCCCCCAGG - Intronic
1164892462 19:31836593-31836615 CTTCCTGCATGCAGACCACCTGG + Intergenic
1165189326 19:34049328-34049350 CTTCCTTCCTGGAGTCACCCAGG - Intergenic
1165642196 19:37399166-37399188 CTTCCTTGATAGAGCCCTCAGGG + Intergenic
1165723971 19:38099970-38099992 CTTCCAGGATGGAGCCCCGCAGG - Exonic
1166441957 19:42823172-42823194 CTTCCCTAAGGGAGAACCCCAGG + Intronic
925333112 2:3074182-3074204 CTTCCTTCAAGGAGGCCACCTGG - Intergenic
930113820 2:47701824-47701846 CTTCCTGGATTGAGATCTCCAGG + Intronic
933659529 2:84916074-84916096 CATCCTTGAGAGAGTCCCCCAGG - Intergenic
935558148 2:104533312-104533334 CTTCCTTGATACAGACCCTAGGG + Intergenic
936012420 2:108933529-108933551 CTCACTTGGTGGAGACCTCCAGG + Intronic
936250439 2:110864359-110864381 CTTTGTGGATGGAGAGCCCCTGG - Intronic
1169332182 20:4724716-4724738 CTTGCTTGATGAAGGCTCCCGGG - Exonic
1175706697 20:61184089-61184111 CTCCCCTGATGTAGACCCCGAGG + Intergenic
1176248361 20:64108266-64108288 CTTCCTTGCTGGACGCACCCTGG + Intergenic
1180091349 21:45535168-45535190 CCTCCTCCAGGGAGACCCCCCGG - Intronic
1182019030 22:27065457-27065479 CCTCCTTAAAAGAGACCCCCTGG + Intergenic
1182593363 22:31399319-31399341 CTTCAGTGCTGGAGACCCCAGGG - Intergenic
1183521931 22:38300624-38300646 CTACCCTGATGGAGGCCCCCAGG - Intronic
1183661354 22:39223336-39223358 CTTCCTCTATGGAGACCCTCAGG + Intergenic
1184303941 22:43581813-43581835 CTTGCATGATGGAGACACCAAGG + Intronic
1185127210 22:49017902-49017924 CATCCTGGAAGGAGACCCCTTGG + Intergenic
1185395240 22:50583269-50583291 CTTCCTTGTCGGAGCGCCCCAGG - Intronic
954516498 3:51182426-51182448 CCTCCAGGATGGAAACCCCCAGG - Intronic
954597801 3:51841740-51841762 CGTCCATGATGGATACTCCCTGG - Intergenic
961378801 3:126483736-126483758 ATCCCTTGATGGAAACCTCCTGG + Intronic
963085891 3:141436239-141436261 CTTACTTGAAGGATATCCCCAGG - Intronic
964685178 3:159387287-159387309 CATCCTTGAGGGATGCCCCCAGG + Intronic
967128878 3:186452302-186452324 CTTCCTTCATGAAGTTCCCCTGG - Intergenic
968129905 3:196186986-196187008 CTTCCCTGATGAAGACCTCCAGG + Intergenic
968542640 4:1175703-1175725 CATCCTAGCTGGAGATCCCCAGG - Intronic
968542668 4:1175791-1175813 CATCCTAGCTAGAGACCCCCAGG - Intronic
968705618 4:2076082-2076104 CCTCCTTCATGGAGCCCCTCAGG + Intronic
969114301 4:4861375-4861397 CTTCCCTGCTGGAGGCCACCGGG - Intronic
969598842 4:8163797-8163819 CCTCTGTGCTGGAGACCCCCTGG - Intergenic
970199986 4:13594466-13594488 ATTCCTTGATGGAAAGCCTCAGG - Intronic
971340601 4:25765325-25765347 CGCCCTGGATGGAGACTCCCAGG - Exonic
972879959 4:43410611-43410633 CATCCTTGAGAGAGGCCCCCAGG + Intergenic
975153434 4:71045153-71045175 CTGCCTTGCTGGAGATCCCAGGG - Intergenic
981316983 4:143349844-143349866 CATCCTTGAGAGAGGCCCCCAGG + Intronic
986176230 5:5354378-5354400 CTGCCTTGAGGGAGAGCCTCAGG + Intergenic
992520484 5:77545661-77545683 CATCCTTGAGAGAGGCCCCCAGG - Intronic
994352929 5:98768161-98768183 CTTTCTTGATAGTGACCCCAAGG + Intergenic
995831429 5:116359870-116359892 CATCCTTCCTGGAGACCCCAGGG + Intronic
997207159 5:132056730-132056752 AAACCTTGAAGGAGACCCCCAGG + Intergenic
998224958 5:140319845-140319867 CTTCCTTATTGGAGACCAACAGG - Intergenic
1001481523 5:172092229-172092251 CTTCAGGGATGGAGGCCCCCTGG - Intronic
1003093562 6:3124461-3124483 CTTCCTGGATCCAGTCCCCCAGG - Intronic
1006453691 6:34120213-34120235 CATCTTTGAAGGAGACCCTCAGG + Intronic
1006924432 6:37646798-37646820 TTTGCATGGTGGAGACCCCCTGG + Intronic
1007643632 6:43363705-43363727 CATCCTTGAGAGAGGCCCCCAGG - Intronic
1007669435 6:43539391-43539413 CATCCTTGAGAGAGGCCCCCAGG + Intronic
1007791488 6:44311439-44311461 CTACTTTGATGGTGACCCCAAGG - Exonic
1008966733 6:57320214-57320236 CTTCCCTGATTGAGAATCCCTGG + Intronic
1021192116 7:17632951-17632973 CTTCCTTGCTGCATACCCCATGG - Intergenic
1021331042 7:19339663-19339685 CTTCCTTTTTGGAGACCCACCGG + Intergenic
1021719340 7:23490770-23490792 CGTCCTTGAGAGAGGCCCCCAGG - Intergenic
1022465833 7:30652870-30652892 CATCCTTCATGGAGCCCCCAAGG + Intronic
1023836029 7:44067666-44067688 CTTCCTGGATGGAGGCCCTGAGG - Intronic
1027420592 7:78014362-78014384 CTTCTTTGATGGAGGAGCCCAGG - Intergenic
1027617379 7:80440127-80440149 CTTCATTGATGGAGAGGCTCAGG + Intronic
1032331681 7:130986461-130986483 CTGCCTTGCTGTTGACCCCCTGG - Intergenic
1032527842 7:132593427-132593449 TTTCCATGATGGACACACCCAGG - Intronic
1032843612 7:135734265-135734287 CGTCCTTGATGGAGATCTGCAGG + Exonic
1034086884 7:148329849-148329871 TTTCCCTGATGCACACCCCCCGG + Intronic
1034589723 7:152129041-152129063 CTGCCGTGAAGGAGAACCCCGGG + Intergenic
1035812761 8:2506251-2506273 CTTCCCTGAAGGAGACCGCACGG + Intergenic
1036451588 8:8872418-8872440 CTTCCTTCATGCGGACCACCTGG + Intronic
1037504517 8:19516785-19516807 CTTCCATGATGGGAGCCCCCAGG + Intronic
1040559116 8:48508225-48508247 CTTCCTTAATGGAAAGCACCAGG + Intergenic
1048344256 8:133565237-133565259 GCTCCCTGATGGAGCCCCCCAGG - Intronic
1049305317 8:141899746-141899768 CTTCCTTGATGGACAGCAGCTGG - Intergenic
1053312107 9:37026726-37026748 CCTCCCTGCTGGAGACCGCCCGG + Intronic
1055772351 9:79730842-79730864 CTTCCTTCATGGAGCCCTCATGG - Intergenic
1055993334 9:82131054-82131076 CATCCTTGAGAGAGGCCCCCAGG - Intergenic
1058023643 9:100117321-100117343 CGTCCTTGAGAGAGGCCCCCAGG + Intronic
1062028091 9:134349763-134349785 CTTCCTGGGTGGACACCGCCAGG - Intronic
1062033961 9:134374521-134374543 CTGGCTTGAGGGAGGCCCCCGGG + Intronic
1062347030 9:136119533-136119555 ATTCCTCGCTGGAAACCCCCAGG - Intergenic
1062474951 9:136722250-136722272 ATTCCTTGATGGAGGTGCCCCGG - Exonic
1185781773 X:2854133-2854155 CTTCCTGGATGCAGACACTCTGG + Exonic
1190876669 X:54465067-54465089 TTTCCTAGATCGAGACCCCAAGG - Intronic
1194055462 X:89126929-89126951 CCTGCTTGATGGAGCCCCCAGGG - Intergenic
1195701656 X:107710225-107710247 CTTCCTTGTCGGAGCCCTCCTGG + Intergenic