ID: 1161965810

View in Genome Browser
Species Human (GRCh38)
Location 19:7547956-7547978
Sequence TAAAGTATACTGAAGGGGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 248
Summary {0: 1, 1: 0, 2: 3, 3: 33, 4: 211}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161965810_1161965818 1 Left 1161965810 19:7547956-7547978 CCCAGCCCCTTCAGTATACTTTA 0: 1
1: 0
2: 3
3: 33
4: 211
Right 1161965818 19:7547980-7548002 ATCAGGGGTGTCCAATCTTTTGG 0: 73
1: 412
2: 681
3: 747
4: 596
1161965810_1161965819 10 Left 1161965810 19:7547956-7547978 CCCAGCCCCTTCAGTATACTTTA 0: 1
1: 0
2: 3
3: 33
4: 211
Right 1161965819 19:7547989-7548011 GTCCAATCTTTTGGCTTCCCTGG 0: 680
1: 1004
2: 719
3: 347
4: 250
1161965810_1161965820 11 Left 1161965810 19:7547956-7547978 CCCAGCCCCTTCAGTATACTTTA 0: 1
1: 0
2: 3
3: 33
4: 211
Right 1161965820 19:7547990-7548012 TCCAATCTTTTGGCTTCCCTGGG 0: 728
1: 1007
2: 643
3: 334
4: 297
1161965810_1161965822 20 Left 1161965810 19:7547956-7547978 CCCAGCCCCTTCAGTATACTTTA 0: 1
1: 0
2: 3
3: 33
4: 211
Right 1161965822 19:7547999-7548021 TTGGCTTCCCTGGGCCACATTGG 0: 419
1: 887
2: 867
3: 500
4: 324

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161965810 Original CRISPR TAAAGTATACTGAAGGGGCT GGG (reversed) Intronic
901695053 1:11001324-11001346 TAAGGGATATGGAAGGGGCTGGG + Intergenic
903145272 1:21368097-21368119 AAAAGTTTATTGAATGGGCTGGG + Intergenic
903285381 1:22273611-22273633 TTAAGTATCCTCAAGGAGCTGGG - Intergenic
903566259 1:24267988-24268010 TAAAGTATACTGGAGGGGACTGG - Intergenic
903566297 1:24268292-24268314 TAAAGTATACAGGAGGGGGCTGG - Intergenic
904511702 1:31015634-31015656 TAAATTACATTGAAGTGGCTGGG - Intronic
905385719 1:37602574-37602596 TAAAGCATCTAGAAGGGGCTAGG - Intergenic
909200735 1:72687529-72687551 AGAAGTTTGCTGAAGGGGCTGGG - Intergenic
910356276 1:86359811-86359833 TAAAGAATAATGAACTGGCTGGG - Intronic
911460498 1:98183024-98183046 TACAGTATACTGAAGGGTGAGGG - Intergenic
911856187 1:102878802-102878824 TTATTTATACTGGAGGGGCTGGG - Intronic
913042441 1:115040640-115040662 TAAAGTATACAGGAGGAGCTAGG + Intergenic
914345092 1:146792126-146792148 TAAAGTAGAAAGAAGGGGCCAGG - Intergenic
915438982 1:155932300-155932322 TAAATTAAAATTAAGGGGCTGGG - Intronic
915572594 1:156752476-156752498 CACAGTTTACTGAAGGGGTTGGG - Intronic
917217850 1:172696618-172696640 TAATATAGTCTGAAGGGGCTTGG - Intergenic
917384928 1:174462012-174462034 TAAGGTATACAGAAGGTTCTTGG - Intronic
919252879 1:195082076-195082098 TAAAATATAATGAACTGGCTGGG - Intergenic
919951868 1:202372164-202372186 GAAAATATAATGAAGGGGCTGGG - Intronic
923825335 1:237493745-237493767 AAAATGATATTGAAGGGGCTGGG - Intronic
924334981 1:242978510-242978532 TAAAAGATACTGAAGAGGCCGGG - Intergenic
1065098530 10:22307806-22307828 TAAAGTATACTGAAGTTGATAGG - Intergenic
1065107931 10:22409221-22409243 GAAAAGATACTGAAGTGGCTGGG + Intronic
1067020257 10:42790556-42790578 TAAAATAGACTGAAGAGGCCGGG + Intronic
1067435215 10:46272305-46272327 TAAAGCAGACAGAATGGGCTGGG + Intergenic
1067438502 10:46295015-46295037 TAAAGCAGACAGAATGGGCTGGG - Intronic
1068243574 10:54336675-54336697 AAAAGTTTGCTGAAGGGGCAGGG + Intronic
1068829459 10:61476644-61476666 TAAAGTATAGTGATGTGCCTAGG + Intergenic
1070139000 10:73722322-73722344 TAAAATAGACTGAAGAGGCTGGG - Intergenic
1072918183 10:99553279-99553301 AAGAGCCTACTGAAGGGGCTGGG - Intergenic
1073311582 10:102546618-102546640 TAAAGTCTCCTGGAGGGGCCTGG - Intronic
1073522689 10:104148843-104148865 TAAGTTATACTGAAGTGGCTAGG - Intronic
1075010839 10:118868958-118868980 TAATTTATCCTGAAGGAGCTGGG + Intergenic
1076185411 10:128443416-128443438 AAAAATATACTGAATGGGATTGG + Intergenic
1078238432 11:9507615-9507637 TTAACTACACTGAAGGGGCTGGG - Intronic
1078939498 11:15986076-15986098 TGTGGCATACTGAAGGGGCTTGG - Intronic
1079255813 11:18828671-18828693 TAAAAAATACAGAATGGGCTGGG - Intergenic
1079397175 11:20074861-20074883 TACAGCACACTGAAGGGTCTGGG + Intronic
1080365674 11:31571091-31571113 AAAGGTATACTGCATGGGCTGGG - Intronic
1081516738 11:43839260-43839282 GAAAGTAGATTGTAGGGGCTGGG - Intronic
1084925903 11:72511067-72511089 TAAAGTCTCCTGAAGGAGCATGG + Intergenic
1085177080 11:74498786-74498808 TAAAAAATACTGTTGGGGCTGGG + Intronic
1085251626 11:75147811-75147833 TCAAGTATATGGCAGGGGCTGGG - Intronic
1085653630 11:78291857-78291879 TAAAAAATACATAAGGGGCTGGG - Intronic
1085706072 11:78787631-78787653 TAGAGTATACTCATGGGGTTGGG - Intronic
1087959537 11:104331435-104331457 TAATGGATATGGAAGGGGCTGGG - Intergenic
1088037631 11:105336177-105336199 TACAGTCTACTGATGGGTCTTGG - Intergenic
1088134637 11:106539697-106539719 TAAGGTATAATGAAAGGACTTGG - Intergenic
1088411312 11:109537910-109537932 TTAAACATGCTGAAGGGGCTGGG - Intergenic
1089375821 11:117993886-117993908 CAAAGGATACTGAAGGGGGTTGG + Intronic
1091442067 12:518693-518715 TAAAGTATATGGGAGGGGCTGGG - Intronic
1091536001 12:1410002-1410024 TAAAGTATATGGGAGGGGCCAGG - Intronic
1091886100 12:4018203-4018225 AACAGTATCCTGAAGGGGCAGGG - Intergenic
1096413119 12:51391417-51391439 GACAGTAAAATGAAGGGGCTGGG - Intronic
1097229534 12:57501386-57501408 TAAAGTATGTTGAAGGGGCTGGG + Intronic
1098342841 12:69470066-69470088 TAGAGTACACTGAAGGGAGTCGG + Intergenic
1099340477 12:81425667-81425689 TAAATAATACTGTAGGGGCTGGG - Intronic
1100332373 12:93596530-93596552 CAAAGGAAACTGCAGGGGCTGGG + Intergenic
1101400461 12:104382457-104382479 TAAAGTATACTTAACGTGGTGGG - Intergenic
1102226429 12:111231810-111231832 TAAAGTATACAGGAGGGGCCAGG + Intronic
1102560729 12:113760452-113760474 TAAAGTATGAGGACGGGGCTCGG + Intergenic
1102794733 12:115679000-115679022 AAAAGTTTGCTGAAGGGGCGGGG + Intergenic
1102883448 12:116503930-116503952 AAAAGTATACAGGTGGGGCTGGG - Intergenic
1107856500 13:44620687-44620709 TAGAGTATACTAGAGGGTCTTGG + Intergenic
1111989464 13:95102577-95102599 CAAAGTATAATGTAGGGGCCAGG - Intronic
1112539232 13:100291115-100291137 TAAAGTATACGGAAAGGGCTGGG + Intronic
1114991297 14:28293448-28293470 TAAAAGATACAGAAGGGGCCAGG - Intergenic
1115162894 14:30415575-30415597 TAAAGTTTCCTGAAGAAGCTAGG - Intergenic
1116437832 14:44913808-44913830 TGAAGAATACTGCAGGAGCTGGG - Intergenic
1117406877 14:55412214-55412236 CAAAGTAGGGTGAAGGGGCTGGG + Intergenic
1121993922 14:98587014-98587036 GAAAGAATACAGAAGTGGCTTGG + Intergenic
1122646870 14:103200506-103200528 TAAAGTGTACAGGAGGGGCTGGG - Intergenic
1123486151 15:20741020-20741042 TGAAATCTACTGAATGGGCTGGG + Intergenic
1123542643 15:21310089-21310111 TGAAATCTACTGAATGGGCTGGG + Intergenic
1124066303 15:26347207-26347229 AAAAGTTTGCTGAAGGGGCAGGG + Intergenic
1126702409 15:51380160-51380182 TAAAGTATGCACAGGGGGCTTGG - Intronic
1127413306 15:58731321-58731343 TAAAGTATATGGGAGGGGCCAGG + Intronic
1128035526 15:64521850-64521872 TAAAGAATAATGAAGGGACAGGG - Intronic
1128089252 15:64907883-64907905 TAAAATACAAAGAAGGGGCTGGG - Intronic
1129125903 15:73441194-73441216 TAAAGCTTACTGAAGGGGTCAGG - Intergenic
1129201101 15:74000601-74000623 TAAAGTATACAGGAGGGGATGGG - Intronic
1129758884 15:78116161-78116183 TAAAGTATATAGGAGGGGCTGGG + Intronic
1131162068 15:90112787-90112809 TAAAGTATACAGACAGGGCTGGG + Intergenic
1132082896 15:98882703-98882725 TAGGGTATACAGAAGGGGCAAGG - Intronic
1202950960 15_KI270727v1_random:37230-37252 TGAAATCTACTGAATGGGCTGGG + Intergenic
1132538528 16:496043-496065 AAAAGTCTACTGGAGGGGCCGGG - Intronic
1138124576 16:54428346-54428368 TAAAGTAGACTAGAGGGGCAGGG + Intergenic
1138555365 16:57767969-57767991 TAAAGTACATGGGAGGGGCTGGG - Intronic
1139988902 16:70923170-70923192 TAAAGTAGAAAGAAGGGGCCAGG + Intronic
1141459513 16:84169714-84169736 AAAAGTGTCCTCAAGGGGCTGGG - Intronic
1144616681 17:16782257-16782279 TACAGCATACTGATGGGTCTTGG + Intronic
1144896010 17:18533404-18533426 TACAGCATACTGATGGGTCTTGG - Intergenic
1145136202 17:20410816-20410838 TACAGCATACTGATGGGTCTTGG + Intergenic
1146392467 17:32435459-32435481 TAAAGTTGAGTGAATGGGCTGGG + Intergenic
1148557369 17:48586474-48586496 TAATGTATGCTGCAGCGGCTCGG + Intronic
1153211912 18:2776502-2776524 TAAAATATAAAAAAGGGGCTGGG - Intronic
1154387199 18:13904862-13904884 TAAGGTATAAGGAAGGGGCCCGG - Intronic
1155103839 18:22641123-22641145 TAAAGTATACTGGAAGGGTTGGG + Intergenic
1155304797 18:24468335-24468357 TAAAGTATACGGGAGGGGCCGGG - Intronic
1156517001 18:37688626-37688648 TGAGGTAGACTGAATGGGCTTGG - Intergenic
1157549202 18:48569557-48569579 TTAAGTATACTGGTGCGGCTGGG - Intronic
1160601337 18:80014820-80014842 AAAAGTTTGCTGCAGGGGCTGGG - Intronic
1161785130 19:6319814-6319836 TAAATAATACAGAAGGGGCCAGG + Intronic
1161965810 19:7547956-7547978 TAAAGTATACTGAAGGGGCTGGG - Intronic
1162631664 19:11932579-11932601 TAAAATATACTGATGTGGATGGG - Intronic
1163373893 19:16918288-16918310 TAAAGTACACAGGAGGGGCCGGG - Intronic
1164694855 19:30235766-30235788 TGAAGCCTATTGAAGGGGCTGGG + Intronic
1166314316 19:41980316-41980338 AAATGTATACTGAATGGGCCGGG + Intronic
1166847865 19:45740901-45740923 TAATGAATACTGAAAGGTCTTGG - Intronic
1168564084 19:57408615-57408637 TAAAATATGTTGAAAGGGCTGGG + Intronic
926273171 2:11383079-11383101 TAAAAGATACTTAATGGGCTGGG + Intergenic
927116660 2:19910170-19910192 TTAAGTATTCTGATGGGGGTTGG - Intergenic
927122637 2:19981812-19981834 TAAAGGAGACTGAAGAGACTGGG - Intronic
933807457 2:86010780-86010802 TAAAATATAATGCAGAGGCTAGG + Intergenic
936445894 2:112594909-112594931 TAAAATAAACAAAAGGGGCTGGG - Intergenic
936657436 2:114504756-114504778 TAAATTAAACTGAGGTGGCTGGG + Intronic
936745396 2:115570409-115570431 TGAAGTATACAGAAGGTGTTGGG - Intronic
938005072 2:127782712-127782734 TAAAGTATACAGCAGGAGCCAGG + Intronic
942234987 2:173895316-173895338 TAAATTATAGTACAGGGGCTGGG - Intergenic
943363401 2:186947143-186947165 TAGAGAATGATGAAGGGGCTGGG - Intergenic
944506263 2:200414744-200414766 TTAATTATACTGAAACGGCTTGG - Intronic
947019233 2:225656319-225656341 TTAAGTATACAGAAGGGACTGGG - Intergenic
947688151 2:232109150-232109172 TAAACTATACTACAGGGGCCAGG + Intronic
948508416 2:238447032-238447054 GAGAGAATACTGAAGGGGCAAGG - Exonic
948872184 2:240807436-240807458 TAAAATATATGGAAGGGGCTGGG - Intronic
949024670 2:241761241-241761263 TAAAGTATACAGGAGGGGCCGGG + Intronic
1171214776 20:23344444-23344466 TGAAGTACACTGAATGTGCTGGG + Intergenic
1171328019 20:24312904-24312926 TAAAGTTTACCGCAGAGGCTTGG - Intergenic
1174083419 20:47987222-47987244 TAAAGAATGCTGTAGTGGCTGGG + Intergenic
1176933681 21:14842508-14842530 TAAATGATACTGAAGGGGAGAGG - Intergenic
1177118346 21:17111739-17111761 TAAGGTATAAGGAAGGGGTTTGG - Intergenic
1177687851 21:24463256-24463278 TCAAGGATACAGAAGGTGCTCGG - Intergenic
1179246477 21:39638107-39638129 TAAATGATACTGAAGGGGGAAGG + Intronic
1179873770 21:44257082-44257104 TAAAACAGACTGGAGGGGCTGGG + Intronic
1180658581 22:17445872-17445894 TAAAGTATACAGCAGTGGCCAGG - Intronic
1183570756 22:38651655-38651677 TGAAATATTCAGAAGGGGCTGGG - Intronic
951214070 3:20007165-20007187 TAAAGTATACAGGAGGGCCCGGG - Intronic
951548577 3:23853949-23853971 TAAAGCATTCTGATGGGCCTGGG - Intronic
953589629 3:44239093-44239115 TAAAGTATACAGAAGGATGTGGG - Intergenic
954792247 3:53142111-53142133 TCAAGTAGGCAGAAGGGGCTGGG - Intergenic
956116897 3:65927993-65928015 TTATGTATACTGAAGGGACTTGG - Intronic
958930991 3:100207964-100207986 TAAAGAAAACTGAAGAGGATAGG + Intergenic
959405764 3:105960324-105960346 CAAATTATGCTTAAGGGGCTTGG - Intergenic
960163255 3:114373207-114373229 GAAAGTATTCTGAGGGGGCAAGG - Intronic
960266895 3:115630444-115630466 TTAAATAGACTGAAGGGACTTGG + Intronic
963394553 3:144715326-144715348 AAAAGTTTACTGCAGGGGCAGGG - Intergenic
964341448 3:155712874-155712896 AAAAGGATACTGAAGGAGATTGG - Intronic
964993816 3:162849507-162849529 TAAAATAAACTGTATGGGCTGGG - Intergenic
965254878 3:166393577-166393599 TAAAATATACAGAATGGGCGGGG - Intergenic
965997511 3:174902766-174902788 TAAAGTATACTCAAGGAGGGCGG + Intronic
967738568 3:192980588-192980610 TAAAGTATAATGAAGGGAAAAGG + Intergenic
970455683 4:16221419-16221441 AAAAATATGCTGGAGGGGCTGGG - Intronic
970635515 4:18005551-18005573 AGAAGTTTACTGCAGGGGCTGGG - Intronic
972845840 4:42988117-42988139 GAAGGTAATCTGAAGGGGCTGGG + Intronic
973918211 4:55657764-55657786 TAGAATATGCTGAAGGGGCAGGG + Intergenic
974687686 4:65251680-65251702 TAAATTATACTGAGGAGGCCAGG + Intergenic
975878783 4:78876513-78876535 TCAGATATGCTGAAGGGGCTTGG + Intronic
978877787 4:113663288-113663310 TAAAGTATATGAAAGAGGCTGGG + Intronic
980255557 4:130376439-130376461 TAAAGCAGACTGAACAGGCTAGG + Intergenic
984836797 4:184029857-184029879 TACAATAAACAGAAGGGGCTGGG + Intergenic
985277416 4:188251376-188251398 GAAAGTATACTACAGTGGCTAGG - Intergenic
988987877 5:36638422-36638444 TAAAGAATTCTGATGGAGCTAGG - Intronic
989657204 5:43757996-43758018 TACAGCATACTGATGGGCCTAGG + Intergenic
991534546 5:67652776-67652798 TAAAATAGACTAAATGGGCTGGG + Intergenic
992418337 5:76574953-76574975 TATAGTATAATGAAGGGGATGGG + Intronic
993851113 5:93010542-93010564 TAAAATATGTTGAAGGGGCCGGG - Intergenic
995442779 5:112210648-112210670 TAAAGATAACTGAAGGGTCTGGG + Intronic
995507920 5:112879769-112879791 TAAAGTATATGGAAGAGGCCGGG - Intronic
996003911 5:118398254-118398276 TAAAGTATAATAAAGAGGATGGG - Intergenic
997308079 5:132855414-132855436 AAAAGTATCCGGAATGGGCTAGG - Intergenic
999503634 5:152172106-152172128 TGAAGTATTCTGCAAGGGCTTGG + Intergenic
1001118235 5:168957358-168957380 TAAAATGGGCTGAAGGGGCTGGG - Intronic
1001714582 5:173804417-173804439 TAAAGTATACAGGAGAGGTTGGG - Intergenic
1001948547 5:175799828-175799850 GAAAGTATATGGAAGGGGCTGGG - Intronic
1004830833 6:19475258-19475280 AAAAGTGTGCTGCAGGGGCTGGG - Intergenic
1007492345 6:42233214-42233236 TAAAGTATACAGAAGGGAAATGG - Intronic
1007600787 6:43079749-43079771 TAAAGTATACAGGAGAAGCTGGG - Intronic
1009292798 6:61904976-61904998 TAAAGTATGTTGAATGGGATAGG - Intronic
1009657107 6:66561572-66561594 TAAAGTTAAGTGAAGGGGCTGGG - Intergenic
1011315921 6:86031023-86031045 TAAAGTTTACAGAAGAGGCAGGG - Intergenic
1013002861 6:106042101-106042123 AAATATATAATGAAGGGGCTGGG - Intergenic
1014172263 6:118291820-118291842 TAAAAAATACTGATGTGGCTGGG + Intronic
1016674456 6:146748077-146748099 TAAAATATAATTAATGGGCTGGG - Intronic
1017256500 6:152339584-152339606 TAAAGTATTCTGTATGGTCTGGG + Intronic
1020537851 7:9424231-9424253 AAAAGTTTGCTGCAGGGGCTGGG - Intergenic
1021329908 7:19323809-19323831 TTAAGTATACTGAAGGTTCAGGG + Intergenic
1022175216 7:27865845-27865867 TAAAGGATACTGAATCAGCTGGG - Intronic
1022682531 7:32563325-32563347 TAAAGTATACGGGAGAGGCTGGG - Intronic
1023283771 7:38597131-38597153 TAAAGTAAACTAAAAGGGCAGGG + Intronic
1023312789 7:38904588-38904610 TAAAGTATGTTAAAGTGGCTAGG - Intronic
1024161209 7:46678375-46678397 TAAAGAATACTGAAGGGGGAAGG - Intronic
1024404697 7:48964766-48964788 TGAAGTCTACTGAAGCGGCTGGG + Intergenic
1025637156 7:63332569-63332591 TAAAGTAAAAAAAAGGGGCTGGG + Intergenic
1025645539 7:63415533-63415555 TAAAGTAAAAAAAAGGGGCTGGG - Intergenic
1026414245 7:70161728-70161750 TAAAGTACTCCAAAGGGGCTGGG - Intronic
1028411115 7:90531167-90531189 TAAAGTATATGGGAGGGGCTGGG - Intronic
1028983401 7:96992043-96992065 TAACGTCTTCTGAAGGGGCTGGG + Intergenic
1029058796 7:97775372-97775394 TAAAGGATCCTGAAGGAGCTGGG - Intergenic
1031096927 7:117431475-117431497 GACAGTATACTGATGGGTCTTGG + Intergenic
1031145744 7:117995191-117995213 AAAAGTTTACTGAAGGGGCAGGG + Intergenic
1031937701 7:127752556-127752578 AAAAGTATAATGCAGGGGCCAGG + Intronic
1032166803 7:129551743-129551765 TTAAGTAAACTGGAGGGGTTGGG + Intergenic
1032575945 7:133054824-133054846 GAAAGTATTCTGAAGAAGCTGGG + Intronic
1032912234 7:136446505-136446527 TCATGTATACTGCAGGGGATGGG - Intergenic
1033524217 7:142194325-142194347 TAAAGAATGCTGGAGGGGCCGGG - Intronic
1033800058 7:144890500-144890522 TGAAGGATACTGATGGGGCCTGG + Intergenic
1034595395 7:152185050-152185072 TAAAGTATACAGGAGGGGCCAGG - Intronic
1034910296 7:154991858-154991880 TAAAGTATACTGATTGAGATAGG + Intronic
1037052493 8:14393763-14393785 TATAGGATATTGAAGCGGCTGGG - Intronic
1038726532 8:30087103-30087125 TAAAGTATACAGGAGGGGCTGGG + Intergenic
1039396745 8:37232290-37232312 TGAAGTGGTCTGAAGGGGCTGGG - Intergenic
1041319457 8:56598453-56598475 TAAAGGATACAGAAGTGGCCAGG - Intergenic
1042073917 8:64967573-64967595 AAAAGTTTGCTGCAGGGGCTGGG - Intergenic
1042314660 8:67412974-67412996 TAAAATATATTGAATGGGCCTGG + Intergenic
1042981894 8:74539236-74539258 TATAGCATACTGATGGGTCTTGG + Intergenic
1043005648 8:74814921-74814943 GAAAGTCTACTGAAAAGGCTGGG + Intronic
1044726150 8:95195858-95195880 CAAAATATACTGAAAGTGCTTGG + Intergenic
1045345836 8:101292671-101292693 TAAACTATAATGGAGGGGGTGGG - Intergenic
1045560074 8:103253097-103253119 TCAAGTATTAAGAAGGGGCTAGG + Intergenic
1045961343 8:107972439-107972461 TAAAATATACAAAATGGGCTGGG - Intronic
1048134325 8:131732764-131732786 CAAAGTATAAAGAAGGGGCCAGG + Intergenic
1048782982 8:138021958-138021980 AAAAGTTTGCTGCAGGGGCTGGG + Intergenic
1054970231 9:71077322-71077344 CAAAGATTACTGAAGGGGTTAGG + Intronic
1055420502 9:76136123-76136145 TGAATTATTCTGAATGGGCTGGG + Intronic
1059482292 9:114600820-114600842 AAAAGTTTGCTGAAGGGGCGGGG - Intergenic
1060306348 9:122416357-122416379 AAAAGTATAATAAAGGAGCTGGG - Intergenic
1060933295 9:127502387-127502409 TAAAGAATAATGAAGGGGGCCGG + Intronic
1186976039 X:14905785-14905807 TAAAGTATATAGGAGGGGCCAGG - Intronic
1188868911 X:35349567-35349589 TAAACAATATTGAAGTGGCTTGG + Intergenic
1189069876 X:37851933-37851955 TGAGGTAAACTGGAGGGGCTTGG + Intronic
1189473073 X:41329313-41329335 GGAAGTATAGTGAAGGGGGTTGG - Intergenic
1192102521 X:68279404-68279426 AAAAGTATACTGTTGGGGCTGGG - Intronic
1192475775 X:71441173-71441195 GAAAATATACAGATGGGGCTTGG - Intronic
1192486506 X:71531906-71531928 AAAAATGTAGTGAAGGGGCTAGG + Intronic
1194297401 X:92143641-92143663 AAAAGTATGCTGCAGGGGCGGGG + Intronic
1194503803 X:94708509-94708531 AAAAGTTTCCTGAAGGGACTGGG - Intergenic
1195248556 X:103020197-103020219 GACAGTATACTGAGGGGTCTTGG + Intergenic
1195343779 X:103928549-103928571 TCAAGAATGCTGAAGGTGCTGGG - Intronic
1195367938 X:104144319-104144341 TACAGTACACTGATGGGTCTTGG - Intronic
1196100284 X:111840320-111840342 TAAAGTATATGGAATGGGCCAGG - Intronic
1196525960 X:116727310-116727332 TGAAGTTTACTGCAGGGGCGGGG + Intergenic
1199567529 X:149230847-149230869 GAAACTATACTGAAGTGGTTTGG - Intergenic
1199931316 X:152525912-152525934 GAAGGTATAATGAATGGGCTTGG - Intergenic
1200614970 Y:5368542-5368564 AAAAGTATGCTGCAGGGGCGGGG + Intronic
1201313137 Y:12615521-12615543 TTAAGAAAACTGAAGTGGCTGGG - Intergenic
1202389836 Y:24358579-24358601 TAAAAGATACTGAAGAGGCCAGG + Intergenic
1202480948 Y:25311535-25311557 TAAAAGATACTGAAGAGGCCAGG - Intergenic
1202582682 Y:26398563-26398585 GAAAATATAATGAAGGGGCCGGG + Intergenic