ID: 1161967493

View in Genome Browser
Species Human (GRCh38)
Location 19:7556552-7556574
Sequence CAGGATAAGCAGATTGAGGT AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 233
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 217}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161967484_1161967493 24 Left 1161967484 19:7556505-7556527 CCATGTTCACTGGGTCTGCCTTT 0: 1
1: 0
2: 1
3: 24
4: 242
Right 1161967493 19:7556552-7556574 CAGGATAAGCAGATTGAGGTAGG 0: 1
1: 0
2: 0
3: 15
4: 217
1161967490_1161967493 -10 Left 1161967490 19:7556539-7556561 CCATCGGGTCTTCCAGGATAAGC 0: 1
1: 0
2: 0
3: 7
4: 74
Right 1161967493 19:7556552-7556574 CAGGATAAGCAGATTGAGGTAGG 0: 1
1: 0
2: 0
3: 15
4: 217
1161967483_1161967493 27 Left 1161967483 19:7556502-7556524 CCTCCATGTTCACTGGGTCTGCC 0: 1
1: 0
2: 0
3: 16
4: 192
Right 1161967493 19:7556552-7556574 CAGGATAAGCAGATTGAGGTAGG 0: 1
1: 0
2: 0
3: 15
4: 217
1161967485_1161967493 6 Left 1161967485 19:7556523-7556545 CCTTTAACCGCAGCATCCATCGG 0: 1
1: 0
2: 0
3: 1
4: 34
Right 1161967493 19:7556552-7556574 CAGGATAAGCAGATTGAGGTAGG 0: 1
1: 0
2: 0
3: 15
4: 217
1161967488_1161967493 -1 Left 1161967488 19:7556530-7556552 CCGCAGCATCCATCGGGTCTTCC 0: 1
1: 0
2: 0
3: 14
4: 160
Right 1161967493 19:7556552-7556574 CAGGATAAGCAGATTGAGGTAGG 0: 1
1: 0
2: 0
3: 15
4: 217

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161967493 Original CRISPR CAGGATAAGCAGATTGAGGT AGG Exonic
903503278 1:23814092-23814114 CAGGATAAGAAGTTTGTGGCAGG + Intronic
905107124 1:35570622-35570644 AAGGAGAAGCAGGTTGGGGTTGG + Intergenic
905119797 1:35672861-35672883 CAGGATCATCAGAAGGAGGTGGG - Intergenic
905284930 1:36873123-36873145 CAGGATGAGGGGAATGAGGTGGG - Intronic
906351048 1:45059896-45059918 CAGGACTACCAGGTTGAGGTGGG + Intronic
906671977 1:47662713-47662735 CAGGGTAGGCAGAGTGAGGCTGG - Intergenic
907569259 1:55467936-55467958 CTGGACAGGCAGATTCAGGTCGG + Intergenic
907673475 1:56497390-56497412 CATCATAAGCACATTGAGGCAGG - Intronic
910053609 1:83005747-83005769 CTGGAGATGCTGATTGAGGTTGG + Intergenic
912031847 1:105256551-105256573 CAGGATCACCCGATTGAGTTGGG - Intergenic
913439048 1:118878044-118878066 TAGGAAAAGCAGATTGAGATTGG + Intergenic
914350117 1:146833211-146833233 CAGAATATGCAGCTGGAGGTAGG - Intergenic
915281951 1:154829023-154829045 CAGGCTCAGCAGGTTGGGGTTGG - Intronic
915727772 1:158030912-158030934 CAGGATGAGCAGATGGAGCTGGG - Intronic
915790669 1:158666852-158666874 TAGGAGAAGCATAATGAGGTTGG + Intronic
916804057 1:168241601-168241623 CAGGTTAAGCAAAATTAGGTAGG + Intronic
920077703 1:203349260-203349282 AAGGGAAAGCAGCTTGAGGTAGG + Intronic
922261775 1:223950269-223950291 GAGCCTGAGCAGATTGAGGTGGG - Intergenic
1063929119 10:11011389-11011411 AAGGATGGGCAGATGGAGGTGGG + Intronic
1064427761 10:15245137-15245159 CAGGATGTGGAGGTTGAGGTGGG - Intronic
1065170004 10:23017670-23017692 CAGGAGAATCAGCTTGAGGCTGG + Intronic
1067205767 10:44211500-44211522 CAGGAGAAGCAGCATGAGGGGGG - Intergenic
1067243458 10:44516544-44516566 CATCACAAACAGATTGAGGTGGG + Intergenic
1067665711 10:48276498-48276520 CAGGTTCAGCAGATTCAGGGTGG - Intergenic
1067976667 10:51033535-51033557 CAGGATAATGACATTTAGGTTGG + Intronic
1068213745 10:53955343-53955365 CAGGGTAATCAGACTGAGTTAGG - Intronic
1068555145 10:58450176-58450198 GAGGATAAGAAGCTTGTGGTTGG + Intergenic
1068764500 10:60748088-60748110 CAGGTGAATCTGATTGAGGTAGG - Intergenic
1069894390 10:71671601-71671623 CATGACAAGCAGATTGGGGCTGG + Intronic
1069905193 10:71728087-71728109 TTGGACAAGCAGATTGAGGAAGG + Intronic
1071582436 10:86785377-86785399 CAGGAGGCGCAGATTGCGGTGGG - Intronic
1072302020 10:94070918-94070940 CAGGAGAAGCGGATTAATGTTGG - Intronic
1073718289 10:106135032-106135054 TAGGATAAGGAGATTGAAGGAGG + Intergenic
1074232724 10:111553847-111553869 CAGGAGAAGCTGACTGAGGGAGG - Intergenic
1075111170 10:119585908-119585930 CAGGAAAACCAGAGTGTGGTAGG - Intronic
1075714381 10:124547687-124547709 CAGGAGAAGCAGTCTGAGGGAGG + Intronic
1076080100 10:127572059-127572081 AAGGATAAGGAGAATGAGGCAGG + Intergenic
1077786081 11:5384752-5384774 TAAAATAAGCAGATTGAGGATGG - Intronic
1077862773 11:6198234-6198256 CAGGACAAGTAGATTGACTTAGG - Intergenic
1078035156 11:7796205-7796227 CAGGGTAACCACAGTGAGGTGGG + Exonic
1081694541 11:45100832-45100854 CACAATAACCAGCTTGAGGTAGG + Intronic
1083045318 11:59729249-59729271 CAGGAGAACCACAATGAGGTGGG - Intronic
1083096951 11:60260809-60260831 CTGGATAAGCTGTTTGAAGTGGG - Intergenic
1086156290 11:83670070-83670092 CTGGATAAGCTGGTTGAGTTAGG - Intronic
1086316665 11:85602103-85602125 GAGGAGAAGCAGACTGAGGGTGG - Intronic
1087879957 11:103404518-103404540 CAGGATAATCAGAGTAATGTTGG + Intronic
1089191232 11:116654768-116654790 CAGCATAAGCAGTATGAGGCTGG - Intergenic
1089959089 11:122599835-122599857 CAGGGAAAGCAGAATGAGGAAGG - Intergenic
1090542368 11:127722392-127722414 CAGGAGGAGAAGAGTGAGGTGGG - Intergenic
1090591382 11:128273841-128273863 AAAGATAAGCAGAGTGAGGGTGG - Intergenic
1090979755 11:131709157-131709179 CAGGATAATAAGAGTAAGGTGGG + Intronic
1092465673 12:8729473-8729495 CAGGAGAAGCAGCTGGACGTCGG - Intronic
1094076987 12:26488068-26488090 CAGGAGAAGCAGTAGGAGGTAGG + Intronic
1095996630 12:48092225-48092247 CAGGATCAGCAGATAAAGGCAGG + Intronic
1096373587 12:51089071-51089093 CAGGAGAAGCAGAATGATGTAGG + Intergenic
1097204154 12:57306063-57306085 CAGGATAAGAATATTAAGGTGGG + Intronic
1097728461 12:63100791-63100813 CAGGGCCAGCAGATTGAGTTGGG + Intergenic
1100725830 12:97407587-97407609 CAGGAGCTGCAGAGTGAGGTTGG - Intergenic
1103601417 12:122057036-122057058 CAGGATAAGCAGACACAAGTAGG + Intronic
1104265847 12:127231843-127231865 GAGGATAAGCAGCTGGACGTTGG + Intergenic
1104492826 12:129209382-129209404 CAGGATAACCAGAATGGGATGGG + Intronic
1109399942 13:61813302-61813324 CAGATTATGCAGATAGAGGTGGG + Intergenic
1111104556 13:83628849-83628871 CAGGAGAAGGAGAGTGAGGGGGG - Intergenic
1111433772 13:88179835-88179857 TAGGGTTAGCAGACTGAGGTGGG + Intergenic
1114985495 14:28222661-28222683 CAGAATAAACAGATAAAGGTTGG + Intergenic
1116543938 14:46138699-46138721 AAGCAAAAGCAGATTGAGGTTGG + Intergenic
1116609486 14:47049277-47049299 CAGGACATGGAGATGGAGGTGGG + Intronic
1117950451 14:61078207-61078229 CTGGATAAGCTCATAGAGGTGGG + Intronic
1118418971 14:65577745-65577767 TAGGAAAAGTAGATTGGGGTAGG + Intronic
1119126402 14:72131159-72131181 CAGAATAAGATGATTGAGTTAGG - Intronic
1122992891 14:105246971-105246993 AAGGATCAGCAGGTTGTGGTGGG - Intronic
1124064328 15:26325851-26325873 CAGGATTAGCAGACTCAAGTGGG - Intergenic
1126055684 15:44727800-44727822 CAGGCTTGGCAGACTGAGGTGGG + Intergenic
1129093762 15:73181608-73181630 CAGGATCAGGAGAGTGAGGTGGG + Intronic
1129749498 15:78051139-78051161 CATGATAAGCAGTTTGTGGCTGG - Intronic
1129790061 15:78335176-78335198 CAGGATCAACAGGTTGAGTTTGG - Intergenic
1131693130 15:94847405-94847427 CAGGATAATCAGATGTAGGAGGG - Intergenic
1131703649 15:94969168-94969190 CAGGATAAGGAGAGGGAGCTGGG + Intergenic
1131946448 15:97627348-97627370 CTGGATGATCAAATTGAGGTTGG + Intergenic
1132001655 15:98186615-98186637 ATAGATAAGCACATTGAGGTTGG + Intergenic
1132061129 15:98693217-98693239 CTGGATGAGCAGAATGAGGCAGG + Intronic
1133635025 16:7657055-7657077 CAGGAAGAACAGATTTAGGTTGG - Intronic
1134872407 16:17663832-17663854 CAGAGCTAGCAGATTGAGGTGGG + Intergenic
1135139836 16:19911949-19911971 CTGAATCAGCAGGTTGAGGTAGG + Intergenic
1135630485 16:24032533-24032555 GTGGATTAGCAGATGGAGGTGGG + Intronic
1135894440 16:26386138-26386160 CAGGGAAAGCAGAGTGAGGCTGG - Intergenic
1137360034 16:47805921-47805943 CAGGATAAGAAGCTAGTGGTGGG + Intergenic
1137693964 16:50448860-50448882 CAGGATTAGCAGATCAAGGGAGG - Intergenic
1138549478 16:57739786-57739808 CAGTATAATCAGATGGTGGTGGG - Intronic
1138999771 16:62495351-62495373 TAGGATAAGAAGATTGGTGTAGG + Intergenic
1139983923 16:70882320-70882342 CAGAATATGCAGCTGGAGGTAGG + Intronic
1140057394 16:71537258-71537280 CACGATATGCAGGTTGAGGGAGG - Exonic
1140923082 16:79557302-79557324 CAAGATCAGCAGTTTGAGGGTGG + Intergenic
1141368922 16:83469444-83469466 CAGGAAAAACATATTGAGGCTGG + Intronic
1142698843 17:1647775-1647797 CAGGCTCAGCAGAATGAGGGAGG + Intronic
1143125067 17:4636685-4636707 CAGGCTAAGGAGTATGAGGTGGG - Intronic
1143181354 17:4986334-4986356 CAGGATGAGAAGTATGAGGTAGG + Intronic
1143437705 17:6941525-6941547 CAGGATAAACTTATAGAGGTGGG - Intronic
1143961805 17:10727438-10727460 CAGGATAAGTAGATTTTGGAGGG + Intronic
1145982492 17:29021372-29021394 CAGGATAAGCTGATAAAGGAAGG - Intronic
1147584175 17:41643582-41643604 CAGGAGAAGCAGGTGGAGCTAGG + Intergenic
1148177503 17:45580018-45580040 AAGGACAGGCAGATTGAGGGAGG - Intergenic
1148742697 17:49901882-49901904 CAGGAGGAGCAGACTGTGGTTGG - Intergenic
1150747827 17:67830606-67830628 AAGGAAAGGCAGATTGAGGGAGG + Intronic
1153464833 18:5377879-5377901 CAGGAAAAGCAGAGAAAGGTGGG + Intergenic
1155037796 18:22039880-22039902 GACGAAAAGCAGTTTGAGGTGGG - Intergenic
1155177615 18:23314439-23314461 CAGGGTAAGCACATTGCAGTAGG - Intronic
1157484694 18:48078520-48078542 CAGCATAAGAAGAGTGAGTTGGG + Intronic
1157991769 18:52504800-52504822 CTGGAGAAGCAGGCTGAGGTTGG - Intronic
1158082940 18:53615728-53615750 CAGGGTAAGCAGGCTGTGGTTGG - Intergenic
1160051198 18:75435380-75435402 CATGATAAGCAGATGCATGTGGG + Intergenic
1161967493 19:7556552-7556574 CAGGATAAGCAGATTGAGGTAGG + Exonic
1162099556 19:8331628-8331650 CAGGGCAAGCAGCTGGAGGTGGG + Intronic
1163054188 19:14706080-14706102 CAGGAGAGGCAGCTGGAGGTGGG - Intronic
1164947357 19:32307658-32307680 CAGGCCATGCAGATTGAGGGAGG - Intergenic
1165988093 19:39788013-39788035 CAGGTTTAGCAGGTTTAGGTAGG - Intergenic
1167077418 19:47257892-47257914 CAGGATGAGCACAGGGAGGTGGG + Intronic
1167948697 19:53009724-53009746 CAGGAAGAGGAGGTTGAGGTGGG - Intergenic
925717560 2:6798258-6798280 CAGGAAAAGCAAAATGAGGAGGG + Intergenic
925866980 2:8236707-8236729 CAGGGCAGGCAGACTGAGGTGGG + Intergenic
925894284 2:8459410-8459432 CAGGATAAGCAGAGGGAAGAGGG - Intergenic
925933152 2:8727184-8727206 CAGCATGAGCAGACTCAGGTGGG - Intronic
926252471 2:11163286-11163308 CAGAATACACAGAATGAGGTGGG + Intronic
926825164 2:16898903-16898925 AAGGATAAGCAGATGGAGGCTGG + Intergenic
927292485 2:21418822-21418844 CAGGATAATCTGATTGAGAGGGG - Intergenic
929556414 2:42928333-42928355 CAGGACAAGCAGAATGGGCTGGG - Intergenic
937369340 2:121286650-121286672 CAGGAACAGCAGAGTGAGGGAGG - Intergenic
937494618 2:122404677-122404699 CAGGATAAGTAGATGGAGCAAGG - Intergenic
939250150 2:139672267-139672289 AAGGATAAGCAGAGTTAGGGTGG + Intergenic
939395124 2:141619145-141619167 CAAGAAAAGCAGGTTGAGGTGGG - Intronic
940553609 2:155193738-155193760 CAGGAAGAGCAGATTGAGCAAGG - Intergenic
941209097 2:162613099-162613121 AAGGATACTCAGATTGAGGGAGG + Intronic
942250568 2:174044167-174044189 CAGGAGAAGGAGGTTGTGGTGGG + Intergenic
942645514 2:178106661-178106683 CAGAAAAATCAGATTGAGGCTGG + Intronic
943810343 2:192179663-192179685 CAGGATCTGGAGATGGAGGTAGG - Exonic
945555439 2:211269892-211269914 CAGGACCAGCAAACTGAGGTGGG - Intergenic
1170192389 20:13657266-13657288 CAGGATAAGCAGGATTAAGTAGG + Intergenic
1171151833 20:22834508-22834530 AAGGATAAGCAGAATCAGGATGG - Intergenic
1172477800 20:35252059-35252081 CAGGAAAAACAGAGTGAGGGTGG - Intronic
1175278343 20:57787139-57787161 CAGGAAAGGCAGTCTGAGGTGGG - Intergenic
1182773259 22:32811212-32811234 AAAGATAAGCAGACTGAGGGGGG + Intronic
1185277323 22:49955394-49955416 CAGGACAGGAAGAATGAGGTGGG + Intergenic
951666132 3:25125932-25125954 CAGGAAAACCAGACTGAGGGTGG + Intergenic
960999926 3:123367357-123367379 CAGGAGAAGCAGTTTGTGGGTGG - Intronic
964023711 3:152045829-152045851 CAGGATAAGCAAAGTTAGGCTGG + Intergenic
964854471 3:161131511-161131533 CAGGAGGTGGAGATTGAGGTGGG - Intronic
966777273 3:183553915-183553937 CAGGATCAGCAGGTTGCTGTGGG - Intronic
969340295 4:6536080-6536102 CAGGCTACACAGAGTGAGGTGGG - Intronic
970552154 4:17193117-17193139 CAGGATAGGCTGATTGTGGCTGG - Intergenic
971165659 4:24180683-24180705 CTGAATAAGCAACTTGAGGTTGG + Intergenic
976264387 4:83176451-83176473 ATGGATAAGCAGCTTGAGCTGGG - Intergenic
979043596 4:115834103-115834125 GAGGGTAAGCAGATATAGGTTGG + Intergenic
979939059 4:126737124-126737146 CAGGATAAGAAGATTGAGAGAGG + Intergenic
980039302 4:127920854-127920876 GAGGACAAGCAGATTGATATTGG + Intronic
980572553 4:134639628-134639650 CTGGATAAGCAGTTTGATGTTGG - Intergenic
980722151 4:136712301-136712323 CAGGATAAGGGGAATGAGGCAGG - Intergenic
981308760 4:143274866-143274888 CAGGAGATGGAGACTGAGGTAGG + Intergenic
981912749 4:150000739-150000761 CTGGAAAAGCAGAATGGGGTAGG - Intergenic
982215789 4:153081694-153081716 CAGGAGAACCAGAGTGTGGTGGG - Intergenic
984463653 4:180069936-180069958 CGGGATAACCAGATTCAGGTAGG - Intergenic
985895441 5:2748200-2748222 CAGAATTAGCAGAGTGAGGGCGG - Intronic
986814405 5:11392593-11392615 CAGGATAAGCAAATTTAGTTTGG - Intronic
986815737 5:11407994-11408016 CAGGAGAAGGAGATTGGGGGAGG + Intronic
986982453 5:13464819-13464841 TAGGAGAAACAGATTGATGTAGG + Intergenic
987785037 5:22488733-22488755 CAGGGTAAGCAGGTTTAGGATGG - Intronic
989609015 5:43273662-43273684 CTGGAAAAGCAGAATGAGGAGGG - Intronic
995918705 5:117284142-117284164 CAGGAGAAGCAGATTGAACACGG - Intergenic
997042970 5:130278973-130278995 CAGAATAAGCTCCTTGAGGTGGG - Intergenic
998754854 5:145366052-145366074 CTGCACAGGCAGATTGAGGTAGG - Intergenic
999254266 5:150201114-150201136 CAGCATGAGCAGGATGAGGTAGG - Exonic
999516995 5:152311374-152311396 CAGCATAAGCAGATCAAGGAGGG - Intergenic
999774958 5:154804710-154804732 CAGGGTCAGCAGATACAGGTTGG - Intronic
1001462867 5:171933692-171933714 CAGGATAAGCAGGTGATGGTGGG - Intronic
1003423074 6:5975342-5975364 AAGAAAAAGCAGATTGAGCTGGG + Intergenic
1004999035 6:21222446-21222468 CAGGATCAACAAATTGAAGTTGG - Intronic
1005988939 6:30891496-30891518 CAGGATATGGAGTTTGGGGTGGG + Intronic
1007212762 6:40208921-40208943 AAGGAGAAGCAGATTTAGATGGG - Intergenic
1012750732 6:103160260-103160282 CAGAATAAGAAATTTGAGGTTGG + Intergenic
1013378684 6:109544539-109544561 CAGGAGAAAGAGAGTGAGGTGGG - Intronic
1013492359 6:110660742-110660764 GAGGAGAAGCAGCTGGAGGTTGG - Intronic
1022591798 7:31670866-31670888 GAGGAGAAGCAGCTGGAGGTCGG + Intergenic
1024147602 7:46533215-46533237 CAGGGCCAGCAGACTGAGGTGGG + Intergenic
1026355296 7:69552141-69552163 CAGGAAAAGCAGATGAGGGTTGG - Intergenic
1026642600 7:72140427-72140449 CAGGAGCAGCAGAAGGAGGTGGG - Intronic
1027216523 7:76187293-76187315 CAGGAGAAGCACTTTGGGGTAGG - Intergenic
1030105244 7:105981785-105981807 TAGGAGAAGCAGATTTGGGTGGG - Intronic
1030282456 7:107791001-107791023 CAAGATGAACAGATTGAGGTGGG + Intronic
1030901455 7:115130107-115130129 CAGTATAAGCAGATTTCCGTGGG + Intergenic
1030921717 7:115397696-115397718 GAGAAAAAGGAGATTGAGGTTGG - Intergenic
1031599197 7:123684938-123684960 CAGGAAAAGAAGATTGGGGAAGG - Intronic
1032090919 7:128911057-128911079 CAGAAGAAGCAGACTGAGCTGGG + Intergenic
1032503288 7:132416198-132416220 CAGGATAACCAGCTGGAGGAAGG + Intronic
1034331527 7:150287319-150287341 AAGGAAAAGCAGAGTCAGGTGGG + Intronic
1034485880 7:151362069-151362091 CAGGATAAAAAGATTGAGGGAGG - Intronic
1034606845 7:152324070-152324092 AAGGATATGAAGATTGAGATAGG + Intronic
1034666516 7:152822542-152822564 AAGGAAAAGCAGAGTCAGGTGGG - Intronic
1036103145 8:5809688-5809710 TAGGAAAAGCAGAGTGATGTTGG - Intergenic
1036671137 8:10788975-10788997 CAGGAAAAGCAGGATGAGGGTGG + Intronic
1038024337 8:23575616-23575638 CAGGGCAAGCAGATTGATGGTGG + Intergenic
1038151938 8:24949827-24949849 GTAGATAAGCAAATTGAGGTTGG + Intergenic
1038666052 8:29539129-29539151 CAGGATAAGTGGATTTGGGTTGG + Intergenic
1038885619 8:31659533-31659555 CAGGAGCAACAGATTGGGGTAGG + Intronic
1039965380 8:42280253-42280275 CAGGGGAAGCAGGTTGTGGTGGG - Intronic
1041793848 8:61725646-61725668 CAGAATAAACAGACTGAGATAGG - Intergenic
1045206259 8:100044215-100044237 CAGAATGAGCAGAATGAGTTGGG - Intronic
1046682126 8:117182157-117182179 CATGAGAAGGAGAGTGAGGTGGG + Intergenic
1046829663 8:118730560-118730582 CAGTATAAACACATTGAGGGAGG - Intergenic
1048276118 8:133067299-133067321 AAGGAGAAGCAGATGGGGGTGGG - Intronic
1050039195 9:1471001-1471023 CAGGACAAGCAGGTTAAGGCAGG + Intergenic
1050735102 9:8752828-8752850 CTGGATCAGCAGTTTGAGCTGGG - Intronic
1052540453 9:29804801-29804823 GAGGAGAAGCAGATGGATGTGGG - Intergenic
1053696051 9:40640349-40640371 CAGGATCAGAATATTAAGGTTGG - Intergenic
1053873045 9:42513776-42513798 CAGGATCAGCATAAAGAGGTGGG + Intergenic
1053899707 9:42782144-42782166 CAGGATCAGCATAAAGAGGTGGG - Intergenic
1054261938 9:62875449-62875471 CAGGATCAGCATAAAGAGGTGGG + Intergenic
1054269285 9:62952976-62952998 CAGGATCAGCATAAAGAGGTGGG - Intergenic
1054307298 9:63439567-63439589 CAGGATCAGAATATTAAGGTTGG - Intergenic
1055398213 9:75895650-75895672 CAGGATAAGCATACTGCGGATGG + Intronic
1055759260 9:79589338-79589360 GATGATAAGCAGAGTGGGGTTGG + Intronic
1056254411 9:84783932-84783954 CAGCATGAGGAGATGGAGGTTGG + Intronic
1056363448 9:85881244-85881266 CAGTAAAGGCAGATAGAGGTGGG - Intergenic
1056521734 9:87408172-87408194 CAGGAAAGGCAGATAGGGGTGGG + Intergenic
1056897114 9:90561381-90561403 CAAGATAAGAACCTTGAGGTTGG + Intergenic
1057147511 9:92768212-92768234 CAGGAGAAGCAGCTGGATGTCGG - Intergenic
1202778498 9_KI270717v1_random:13962-13984 CAGGATCAGAATATTAAGGTTGG - Intergenic
1185775569 X:2800403-2800425 CAGGGCCAGCAGACTGAGGTGGG - Intronic
1189826265 X:44921321-44921343 CAAGATAAGGAGATTGACATTGG + Intronic
1190048010 X:47128002-47128024 CAGGAGAAGGAGAGAGAGGTAGG + Intergenic
1190092707 X:47453448-47453470 CAGAATAAACAGATTCAGGGAGG + Intronic
1195737835 X:108032054-108032076 CAGGAAAAGAAAATTGAAGTGGG - Intergenic
1198131238 X:133697432-133697454 CAAGCTCAGCAGATTGAGGAAGG - Intronic
1200037184 X:153339423-153339445 CAGCATTCGGAGATTGAGGTGGG + Intronic
1201294348 Y:12450954-12450976 CAGGACCAGCAGACTGAGGTGGG + Intergenic