ID: 1161971326

View in Genome Browser
Species Human (GRCh38)
Location 19:7582524-7582546
Sequence CTGCATGCTGAGATGGGGAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161971326_1161971331 4 Left 1161971326 19:7582524-7582546 CCTGTCCCCATCTCAGCATGCAG No data
Right 1161971331 19:7582551-7582573 ACCATCTACCTGCTTGCGAAAGG No data
1161971326_1161971335 16 Left 1161971326 19:7582524-7582546 CCTGTCCCCATCTCAGCATGCAG No data
Right 1161971335 19:7582563-7582585 CTTGCGAAAGGCAGAGATCTGGG No data
1161971326_1161971334 15 Left 1161971326 19:7582524-7582546 CCTGTCCCCATCTCAGCATGCAG No data
Right 1161971334 19:7582562-7582584 GCTTGCGAAAGGCAGAGATCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161971326 Original CRISPR CTGCATGCTGAGATGGGGAC AGG (reversed) Intergenic
No off target data available for this crispr