ID: 1161975204

View in Genome Browser
Species Human (GRCh38)
Location 19:7604691-7604713
Sequence ACTCTTCAACACCAGGACTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 176
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 166}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161975204_1161975211 -9 Left 1161975204 19:7604691-7604713 CCCCAGTCCTGGTGTTGAAGAGT 0: 1
1: 0
2: 0
3: 9
4: 166
Right 1161975211 19:7604705-7604727 TTGAAGAGTTATTTGGCCTGGGG 0: 1
1: 0
2: 2
3: 17
4: 184
1161975204_1161975212 -4 Left 1161975204 19:7604691-7604713 CCCCAGTCCTGGTGTTGAAGAGT 0: 1
1: 0
2: 0
3: 9
4: 166
Right 1161975212 19:7604710-7604732 GAGTTATTTGGCCTGGGGCAAGG 0: 1
1: 0
2: 2
3: 24
4: 217
1161975204_1161975210 -10 Left 1161975204 19:7604691-7604713 CCCCAGTCCTGGTGTTGAAGAGT 0: 1
1: 0
2: 0
3: 9
4: 166
Right 1161975210 19:7604704-7604726 GTTGAAGAGTTATTTGGCCTGGG 0: 1
1: 0
2: 1
3: 16
4: 131
1161975204_1161975213 -3 Left 1161975204 19:7604691-7604713 CCCCAGTCCTGGTGTTGAAGAGT 0: 1
1: 0
2: 0
3: 9
4: 166
Right 1161975213 19:7604711-7604733 AGTTATTTGGCCTGGGGCAAGGG 0: 1
1: 0
2: 1
3: 24
4: 301

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161975204 Original CRISPR ACTCTTCAACACCAGGACTG GGG (reversed) Intronic
902043238 1:13507338-13507360 ACTCATCAACAGCAGGACAGAGG + Intronic
902204189 1:14855301-14855323 ACTCCTTATCAGCAGGACTGGGG - Intronic
902863077 1:19259735-19259757 ACACTTCCAAACCAGGGCTGCGG + Exonic
907762994 1:57379864-57379886 ACTCATTAACACCACGACTTTGG + Intronic
908761145 1:67513051-67513073 AGTCTTCAATTCCAGAACTGAGG + Intergenic
909066657 1:70942923-70942945 ACTTTTCACCTCCAAGACTGTGG + Intronic
910528293 1:88206427-88206449 TCACATCAAAACCAGGACTGAGG + Intergenic
912416665 1:109513011-109513033 ATTCTGAATCACCAGGACTGGGG + Intergenic
915146161 1:153796795-153796817 ACCCTTCAACACCCGGCTTGGGG - Intergenic
915465294 1:156094047-156094069 ACTCTCCAGCACCTGGTCTGGGG + Intronic
915608197 1:156968453-156968475 ACTCTTCATCACCAACTCTGTGG + Intronic
916182160 1:162094796-162094818 ACTCTTCAACAACTGGACCATGG - Intronic
920277081 1:204814329-204814351 TCTCTTCATCCCCACGACTGGGG + Intergenic
920865022 1:209744633-209744655 ACTGTTCCACTCCAGGAATGGGG - Intergenic
1064692736 10:17934498-17934520 AGTCTTCAACTCCTGGACTCAGG + Intergenic
1064925458 10:20564312-20564334 ACTCTTCACAACCTGAACTGGGG - Intergenic
1069180644 10:65354230-65354252 ACTCTTCATCAACAAAACTGAGG + Intergenic
1069280082 10:66644823-66644845 ACTGTTCAACATCTTGACTGCGG - Intronic
1072031575 10:91526968-91526990 ACTTTTCATCTCCAGAACTGTGG - Intergenic
1073443222 10:103565020-103565042 ACTCTTCTAAACCAGGGCTGGGG - Intronic
1074551100 10:114443289-114443311 AATCTTCAATACAAGAACTGAGG - Intronic
1074882129 10:117667561-117667583 TCTTGTCAACACCAGGAATGGGG + Intergenic
1075411736 10:122233487-122233509 CCTCTTCTAAGCCAGGACTGAGG - Intronic
1076310402 10:129502182-129502204 ATTCTTCAAAGCCTGGACTGCGG - Intronic
1078388280 11:10912361-10912383 GCTCTTCAACCCCATCACTGAGG - Intergenic
1079354912 11:19722868-19722890 GCTCTCCAACACCAGGTCTTAGG + Intronic
1081584358 11:44374253-44374275 ACTCTTCAGCACCAGTGGTGTGG - Intergenic
1082797220 11:57387032-57387054 TCTCTCCAACCCCAGAACTGTGG - Exonic
1084211126 11:67623201-67623223 ACGATCCAACAACAGGACTGAGG + Intergenic
1085350642 11:75796143-75796165 ACTGCCCAACACCAGCACTGTGG + Intronic
1086537699 11:87868128-87868150 AGGCTTCAACTCCAGCACTGGGG - Intergenic
1088075304 11:105841416-105841438 ACTCCTTCACAGCAGGACTGTGG + Intronic
1088878835 11:113957864-113957886 ACTCTCCACCACCAGGGCTCTGG - Intergenic
1092666007 12:10798980-10799002 ACTCTTCAGCAACAGTACTTAGG - Intergenic
1093073395 12:14731707-14731729 ACTCTTACACAGCAGGAATGAGG - Intergenic
1095559829 12:43551855-43551877 GCTCTTCATCACCAGGTCTTGGG - Exonic
1097595164 12:61620483-61620505 ACCCATCAGCACCAGGAATGAGG + Intergenic
1100246316 12:92761007-92761029 TCTCTTCAAGACAAGGAGTGGGG + Intronic
1100367560 12:93935663-93935685 AGGCTTCAACAGCAGGACTTAGG - Intergenic
1100809204 12:98321419-98321441 ACTCTTAGACACCAGCACTCAGG + Intergenic
1101115869 12:101530751-101530773 CCTCTTCCCCACCAGGACAGTGG - Intergenic
1101238458 12:102813724-102813746 ACTCTTCAACCTTAGGACTGTGG - Intergenic
1101740084 12:107493908-107493930 ACTCTGCAACACCTTGAGTGTGG + Intronic
1102428520 12:112863205-112863227 ATTCTGAAACACCAGGTCTGAGG - Intronic
1103621031 12:122187468-122187490 ACACTTCAACATCTGGAATGGGG - Intronic
1103701112 12:122849175-122849197 ATTCTTCAGCAGCAGGTCTGGGG - Intronic
1105679722 13:22713883-22713905 CATCTTCAACACCAGGGCTTTGG + Intergenic
1106931293 13:34668566-34668588 TCTCTTCTTCACCAGGCCTGTGG + Intergenic
1107088833 13:36454022-36454044 ACTCCTCAACACCTGGGCTTAGG + Intergenic
1107362290 13:39632568-39632590 ATCCTTCAACCCCAGGCCTGTGG - Intergenic
1108339732 13:49486715-49486737 ACTCTGAAACACAAGGACTCAGG - Intronic
1110726532 13:78831399-78831421 GGTCTTGAACACCTGGACTGAGG + Intergenic
1110809592 13:79797083-79797105 ACTCTTTAATAGGAGGACTGTGG - Intergenic
1112542309 13:100327157-100327179 AGTGTTCAACACCATGGCTGTGG - Intronic
1113323383 13:109259353-109259375 ACTCTTCAACAAAGGGACAGAGG + Intergenic
1114680220 14:24478103-24478125 ACTCTTCTACACCATGAGTATGG + Intergenic
1115466524 14:33720582-33720604 ACTGTACATCAGCAGGACTGTGG + Intronic
1117492506 14:56264271-56264293 ACACTTCAACACCATGGTTGGGG - Intronic
1121276168 14:92669413-92669435 ATTCTGCAATGCCAGGACTGGGG + Intronic
1122313230 14:100810563-100810585 ACTCTTGAACATCAGGGATGGGG + Intergenic
1127466576 15:59250076-59250098 TCTCTTCTGCACCAGGGCTGTGG - Intronic
1128916196 15:71565088-71565110 AATCTTGAATACAAGGACTGTGG + Intronic
1135808145 16:25562699-25562721 AATGTTCCACACAAGGACTGTGG + Intergenic
1138236232 16:55385528-55385550 ACCCTTCAATTCCAGGACTGTGG + Intergenic
1139563648 16:67759318-67759340 GCTGTTCAGCACCAGGGCTGTGG - Intronic
1139917344 16:70436980-70437002 AGTCTGCAATACCAGGATTGGGG - Intronic
1141792930 16:86248974-86248996 ACCCTTCAAGACCAGGGATGGGG + Intergenic
1142073258 16:88103045-88103067 ATTCTTTAACACCAAGAATGGGG + Intronic
1145900492 17:28487764-28487786 ACTCATCAGCCCCAGGATTGGGG - Intronic
1146310631 17:31765637-31765659 ATGATTCAACAACAGGACTGAGG + Intergenic
1147742362 17:42676490-42676512 ACTCTTCTGCACCGGGACTACGG - Exonic
1147910873 17:43855236-43855258 GCTCAGCAGCACCAGGACTGGGG - Exonic
1148633968 17:49133009-49133031 ACTCTGCACCCCCAGGAATGGGG + Exonic
1148697100 17:49567307-49567329 ACTCCTGAACACCCGGCCTGAGG - Intergenic
1149231432 17:54538274-54538296 ACTCTTCAATAAAAGGACAGAGG + Intergenic
1149363344 17:55916262-55916284 ACTCTTCCCCACCAAGACTGTGG + Intergenic
1153862100 18:9222371-9222393 ACTCGTTAACACCAGGACACCGG - Intronic
1156016917 18:32556880-32556902 ATTCTTCAACTCCAGACCTGAGG - Intergenic
1159265018 18:66069419-66069441 ACTCTTCAACACCAGACCCTGGG - Intergenic
1161359217 19:3837294-3837316 ATTCATGAACACCATGACTGTGG + Intronic
1161975204 19:7604691-7604713 ACTCTTCAACACCAGGACTGGGG - Intronic
1162003720 19:7764048-7764070 ATCCTGCAACACCAGGACTCAGG - Intronic
1166381788 19:42358580-42358602 ACTCGTATAAACCAGGACTGAGG + Intronic
1166843187 19:45711474-45711496 ACTCTTCAGAACCAGGGCCGTGG - Exonic
1167939490 19:52935087-52935109 ACGCTTCATCACCCAGACTGGGG + Intronic
926510305 2:13768383-13768405 ACTCTTCAAAAAGAAGACTGTGG + Intergenic
926672376 2:15588375-15588397 AGTCTTCAACAACTGGATTGTGG - Intergenic
928663763 2:33530029-33530051 TCTCCTCAACATGAGGACTGAGG + Intronic
929777884 2:44939738-44939760 GGTCTTCAACACGACGACTGGGG - Intergenic
930274450 2:49295444-49295466 ACTTTACAACAGCAGAACTGAGG + Intergenic
933086603 2:78061198-78061220 TCCCTACAACACCAGGAATGGGG - Intergenic
933624919 2:84587582-84587604 TCTCTGCAACAGCAGGAATGAGG - Intronic
935446836 2:103166322-103166344 CCGCTGCAACACCAGGCCTGTGG + Intergenic
941099651 2:161282044-161282066 ACTCTTCACCCCCAGGCCTCAGG + Intergenic
942195776 2:173518321-173518343 ACTCTTTCACACAAGAACTGAGG + Intergenic
942254697 2:174085238-174085260 AGTCCTCAACCCCTGGACTGTGG + Intronic
943912210 2:193583710-193583732 ACTGTTCACCACCAATACTGAGG + Intergenic
948770432 2:240248913-240248935 CATCTTCAACACCAGCCCTGAGG + Intergenic
1170150763 20:13222944-13222966 AGTCTCCAACACCTGGCCTGAGG - Intronic
1173087589 20:39939070-39939092 AGTCTTCCCCACCAGGACTTTGG + Intergenic
1175491990 20:59385493-59385515 GCTCGTCATCACCATGACTGTGG - Intergenic
1180237950 21:46476421-46476443 ACTCTTCTCCAAGAGGACTGTGG - Intronic
1180259251 21:46656744-46656766 AATCTTCATCACCTGGACTTGGG + Intronic
1184456295 22:44611634-44611656 GCTCTTCCACACCATGACAGGGG + Intergenic
1185209351 22:49560634-49560656 ACACTTCAACCCCTGAACTGTGG - Intronic
1185293536 22:50041130-50041152 ACTCACCAACACCAAGAGTGAGG + Intronic
949582229 3:5400380-5400402 ATTTTTCAAAACCAGGAATGAGG - Intergenic
950802507 3:15565635-15565657 ACTGTTAAATAACAGGACTGTGG + Intronic
951829508 3:26909606-26909628 ATTATTGAACTCCAGGACTGTGG - Intergenic
952031842 3:29152319-29152341 GCTGTTGTACACCAGGACTGTGG - Intergenic
952867485 3:37863537-37863559 CCTCGTGAACACCTGGACTGAGG + Intronic
952947708 3:38490690-38490712 ACTGTTCAACATGAGGTCTGAGG - Exonic
953414981 3:42710509-42710531 ACCCTTCAACTCCAGGACCCTGG - Intronic
954006218 3:47593125-47593147 ACTCTTTAAAACCAAGACTACGG - Intronic
954999811 3:54917287-54917309 ACTCTTCAAGACCATGTCTGTGG + Intronic
957720633 3:83993493-83993515 ACTCTTCCAAACCATGAATGTGG + Intergenic
959059381 3:101602306-101602328 ACTCTCCATCACCAAGAGTGGGG + Intergenic
960264010 3:115599482-115599504 GGTCCTCAACACCAGGGCTGTGG + Intergenic
962809627 3:138949523-138949545 CCTCTTCTTCACCAGGGCTGGGG - Exonic
965622387 3:170654635-170654657 CCTCTTCCACCCCAGGAATGGGG + Intronic
970067575 4:12116405-12116427 AGCCTTCACCACCAGAACTGTGG - Intergenic
974838763 4:67279137-67279159 ACAATCCAACAACAGGACTGAGG - Intergenic
974969129 4:68803428-68803450 ATTATTCAGCAACAGGACTGAGG + Intergenic
981686286 4:147458505-147458527 ATTCCTCAACACCTGGCCTGAGG + Intergenic
985665933 5:1181544-1181566 AGCCTTCAAGGCCAGGACTGGGG - Intergenic
987712194 5:21514867-21514889 CCACATCATCACCAGGACTGTGG - Intergenic
988453042 5:31362353-31362375 ACACTTCCACTCCAGGATTGGGG + Intergenic
991762554 5:69934003-69934025 CCACATCATCACCAGGACTGTGG - Intergenic
991784771 5:70184103-70184125 CCACATCATCACCAGGACTGTGG + Intergenic
991841782 5:70809053-70809075 CCACATCATCACCAGGACTGTGG - Intergenic
991877219 5:71184496-71184518 CCACATCATCACCAGGACTGTGG + Intergenic
997072491 5:130636768-130636790 ATGATTCAACAACAGGACTGAGG + Intergenic
997285286 5:132673463-132673485 ACTCTCCTACCCCAGCACTGGGG - Intergenic
1000618008 5:163451439-163451461 ACTCTTCAATACTCTGACTGTGG + Exonic
1005438648 6:25841212-25841234 CCTCTTCCCCACCAGGACTTTGG - Intronic
1007535978 6:42589060-42589082 AGTCTTAAACACCTGGACTTGGG + Intronic
1007590594 6:43018474-43018496 AGTCTTTGACACCAGAACTGAGG + Exonic
1008048881 6:46879860-46879882 ACTTTTCAACAACATGACTTCGG - Exonic
1009005513 6:57781828-57781850 CCACATCATCACCAGGACTGTGG + Intergenic
1013790728 6:113833748-113833770 ATCCTTCAACACAAGGACTCCGG + Intergenic
1017725986 6:157276212-157276234 AATCTTCAACACCAGGGGTTTGG + Intergenic
1020992597 7:15219637-15219659 ACTCTTCAGCACCCAGGCTGTGG + Intronic
1021169264 7:17378378-17378400 ACTCTTCAACACCAATGCTATGG + Intergenic
1022206974 7:28174334-28174356 AGTCTACAACACCAGGCCTCTGG + Intronic
1023995471 7:45156819-45156841 ACTCTTCAAGGCCAGGTCTTTGG + Intergenic
1028281416 7:88934317-88934339 ACTCTTCTACACATGGACTTAGG + Intronic
1029975400 7:104828634-104828656 ATTCTTCAACCTCAGGAGTGGGG + Intronic
1034443137 7:151097708-151097730 ACTCTTCAACAGCCGCAGTGGGG + Intronic
1034753597 7:153593390-153593412 AATCTTCACCTCCAGGGCTGAGG + Intergenic
1037957136 8:23068745-23068767 ACTCACCAACAGCAGGACCGCGG + Exonic
1039823863 8:41156750-41156772 ACTCCTCAACCCCAGCACTTAGG - Intergenic
1044316159 8:90751699-90751721 ACTCCTCCACACCACAACTGTGG + Intronic
1045008110 8:97933535-97933557 CCTATTCGACACCAGGATTGCGG - Intronic
1049257126 8:141620115-141620137 AGACGTCAACACCAGGGCTGTGG + Intergenic
1049257152 8:141620206-141620228 AGACGTCAACACCAGGGCTGTGG + Intergenic
1049257178 8:141620296-141620318 AGACGTCAACACCAGGGCTGTGG + Intergenic
1049257205 8:141620387-141620409 AGACGTCAACACCAGGGCTGTGG + Intergenic
1050086173 9:1968091-1968113 GCTATTCAACACCACGACTGTGG + Intergenic
1052057699 9:23922704-23922726 ACAATTCAACAACAGGACTGAGG - Intergenic
1055924290 9:81494095-81494117 ACTCTGCAAAACCATGACTATGG - Intergenic
1056547844 9:87627698-87627720 ACTCTTCAACCACAGGAGTGTGG + Intronic
1057793716 9:98141214-98141236 CCTCTTCTACAGCAGGACAGGGG + Intronic
1058306531 9:103449204-103449226 ACTCTTGAACACCCGAAATGTGG - Intergenic
1059443093 9:114321821-114321843 AGTCTTGAACTCCAGGACTCAGG + Intergenic
1061263439 9:129492376-129492398 ACCCTTCAACAACAGCCCTGAGG - Intergenic
1061368523 9:130185163-130185185 TGTCGTCACCACCAGGACTGAGG - Intronic
1185599591 X:1329774-1329796 ACTCCTGACCTCCAGGACTGGGG + Intergenic
1185777114 X:2812286-2812308 ATTCTTCAAACCCAGGAGTGTGG - Intronic
1196908538 X:120462763-120462785 GCTCTTCCACTCCAGGAATGGGG - Intronic
1198090637 X:133325824-133325846 GCTTTTCAAAACCTGGACTGAGG + Intronic
1199421372 X:147648842-147648864 AGTCTTCAAATCCAGCACTGGGG - Intergenic
1199678594 X:150208215-150208237 AATATTGAAAACCAGGACTGTGG - Intergenic
1200065099 X:153500452-153500474 ACTCTCCACCACCACAACTGAGG - Intronic
1200092000 X:153640355-153640377 CCTCTTCATCCCCAGGGCTGGGG - Intergenic
1200880739 Y:8209239-8209261 ACAATCCAACAACAGGACTGAGG - Intergenic
1201292900 Y:12439175-12439197 ATTCTTCAAACCCAGGAGTGTGG + Intergenic