ID: 1161977348

View in Genome Browser
Species Human (GRCh38)
Location 19:7613773-7613795
Sequence GGGGTGGTAGGAGCGTGCTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 325
Summary {0: 1, 1: 0, 2: 11, 3: 34, 4: 279}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161977348_1161977363 21 Left 1161977348 19:7613773-7613795 CCCCAGCACGCTCCTACCACCCC 0: 1
1: 0
2: 11
3: 34
4: 279
Right 1161977363 19:7613817-7613839 CCACTGTCTCTCCATTCCCATGG 0: 1
1: 0
2: 9
3: 38
4: 320

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161977348 Original CRISPR GGGGTGGTAGGAGCGTGCTG GGG (reversed) Intronic
900264404 1:1750174-1750196 GGGGTGGTAGCAGGGTGGGGCGG - Intergenic
900693009 1:3992982-3993004 GGGCTGGGATGAGCGTGCTGGGG + Intergenic
900824722 1:4917249-4917271 GGGGTGGAAGGAGGGTGATCAGG - Intergenic
901145200 1:7060137-7060159 GGGGTGGTATGAGTATGCTGTGG + Intronic
901392611 1:8956872-8956894 GGGCGGGAAGGAGCGTGCTGGGG + Intronic
902393101 1:16117521-16117543 GAGCTGGTAAGATCGTGCTGAGG + Intergenic
902580339 1:17403980-17404002 GGGTGGGTGGGAGAGTGCTGGGG + Intergenic
902875515 1:19338516-19338538 GCGGCGGGAGGTGCGTGCTGCGG + Intergenic
904530629 1:31166482-31166504 GGGGTGGGGGGTGCGTGTTGTGG + Intergenic
904914482 1:33960102-33960124 GGGATGGTAAGAGTGGGCTGGGG - Intronic
905810400 1:40908484-40908506 GGGATGGGAGGACCGTCCTGGGG + Intergenic
907220843 1:52905919-52905941 GGGGTGGCAGGAGAGAGCGGTGG + Intronic
907411613 1:54287423-54287445 GGGGTGGGAGGTGTGTGCTGAGG + Intronic
907911715 1:58833150-58833172 GGGTTGGAAAGAGCATGCTGGGG + Intergenic
913144669 1:115976966-115976988 GTGGTGGAAGGAGCGTGTTGGGG + Intronic
913971742 1:143422120-143422142 AGGGTGGTGGGGGTGTGCTGGGG - Intergenic
914920885 1:151846869-151846891 GGTGTGGGAGGAGCGTGATAGGG + Intergenic
915470919 1:156125315-156125337 GGGGTGGTAGGAGTGGCTTGGGG + Intronic
915507543 1:156367237-156367259 GGGGAGGTAGAAGTGAGCTGGGG + Intronic
915532677 1:156512146-156512168 GGGGTGGAAGGAGGGCACTGGGG + Intergenic
917797256 1:178541563-178541585 GTGGTGGGGGGAGCGGGCTGGGG - Intronic
918920456 1:190703053-190703075 AGGGTGGTAGGAGTGTTTTGGGG + Intergenic
919160680 1:193826111-193826133 GGAATGATAGGAGGGTGCTGAGG + Intergenic
919707428 1:200690669-200690691 GGGGTGGGAGGAGAGTGCACTGG + Intergenic
921931085 1:220754848-220754870 GGGGTGGGTGGAGAGTTCTGAGG + Intronic
922756823 1:228101677-228101699 GGTGGGGCAGGGGCGTGCTGTGG - Intronic
923106145 1:230855499-230855521 GGGATGGGAGGAGCATGGTGAGG - Intronic
1063837338 10:10030595-10030617 GGGAGGGTAGGAGGGGGCTGAGG + Intergenic
1064762252 10:18633257-18633279 GGGGTGGTGGGAGCGGGGAGGGG + Intronic
1065290394 10:24223827-24223849 GGGGTGGGTGGTGGGTGCTGGGG - Intronic
1066306371 10:34146794-34146816 GTGGTGATAGGAGCATGCAGTGG - Intronic
1067578039 10:47420122-47420144 GGAGTGGGAAGGGCGTGCTGGGG - Intergenic
1075576105 10:123578689-123578711 GGGTAGGGAGGAGGGTGCTGAGG - Intergenic
1075702641 10:124479140-124479162 GGGGAGGAGGCAGCGTGCTGAGG + Intronic
1075747589 10:124738459-124738481 GAGTTTGTAGGAGCGTGCTGGGG - Intronic
1076353797 10:129838097-129838119 GGCGTGGTTAGGGCGTGCTGGGG + Intronic
1077222371 11:1423428-1423450 GGAGGGGTAGGGGTGTGCTGTGG + Intronic
1077311634 11:1891401-1891423 GGGGCGGAAGGAGCCTGCTTAGG + Intronic
1078325715 11:10379117-10379139 GTGGTGGTAGGAGTGTGGAGTGG + Intronic
1079025697 11:16946099-16946121 GGGGCAGCAGGAGCCTGCTGTGG + Intronic
1079453470 11:20617623-20617645 GGGGTGGGTGGAGGATGCTGGGG + Intronic
1081656043 11:44858273-44858295 GAGATGGTAGCAGGGTGCTGTGG - Intronic
1083660857 11:64251304-64251326 GTGGTGGAAGGAGGGCGCTGGGG - Intergenic
1083669454 11:64291957-64291979 GAGGCGGTGGGAGCGAGCTGCGG + Intronic
1083721977 11:64607747-64607769 GGGGTGACAGGAGGGTGGTGCGG + Exonic
1084357182 11:68647713-68647735 GTGGGGTTAGGAGCGTGCTGAGG + Intergenic
1084392844 11:68890159-68890181 GGGGTGGTGGGAGGGACCTGGGG - Intergenic
1085201503 11:74704932-74704954 GGGGTGGGCAGAGGGTGCTGAGG + Intronic
1086888148 11:92226407-92226429 GGGGTGGCGGGGGCGTGCTTGGG + Intergenic
1089343982 11:117778349-117778371 GGAGTGGAAAGAGCGGGCTGGGG + Intronic
1089502735 11:118941793-118941815 GGGGTGGGAGGGGCAGGCTGTGG - Intronic
1089816975 11:121184498-121184520 GTGGTGGTCAGAGAGTGCTGTGG + Intronic
1091206489 11:133824774-133824796 GGGGAGGTGGGAGCGGGGTGCGG - Intergenic
1091223750 11:133945879-133945901 GCGGTGGGAGGAGAGGGCTGTGG - Intronic
1091345813 11:134853224-134853246 AGGGTGTTAAGAGGGTGCTGGGG + Intergenic
1091723645 12:2830939-2830961 GGGGTGGGGGGAGCATCCTGGGG - Intronic
1092865119 12:12753602-12753624 GAGGTGGTAGCAGTGAGCTGTGG + Intronic
1096027146 12:48376459-48376481 AGGGTTGTATGAGCATGCTGAGG + Intergenic
1096500165 12:52060036-52060058 GGGGTGGCAGGAGAGTGGGGAGG - Intergenic
1096868088 12:54577026-54577048 GGGGTGGTAGGGTGGTGTTGAGG + Intronic
1097180091 12:57166924-57166946 GGGGGGGCAGGTGCGGGCTGGGG - Exonic
1098013522 12:66080114-66080136 GGGGTGATAGGAGAGTGATGTGG + Intergenic
1100048820 12:90418577-90418599 GGGGTGGTAGGAGCAGGGGGAGG + Intergenic
1101331871 12:103763580-103763602 GGGGTCGTAGGAAGGTTCTGGGG - Exonic
1103740591 12:123088539-123088561 GGGGTGGCAGGAGGGTGGTGTGG + Intronic
1104940303 12:132392028-132392050 GGGGTGGTTGGAGGGTCCCGGGG - Intergenic
1104940529 12:132392513-132392535 GGGGTGGTTGGAGGGTCCCGGGG - Intergenic
1105331465 13:19420583-19420605 GGGGTGGAGGGAGAGGGCTGCGG + Intergenic
1106257092 13:28031729-28031751 TGGGTGGGAGGACAGTGCTGGGG + Intronic
1108698728 13:52925794-52925816 GGGGTGGTAGGAGTGGGATGGGG + Intergenic
1110619475 13:77578852-77578874 GGGGAGGAAGGAGTGTGCTCAGG + Intronic
1111823708 13:93243581-93243603 GGGGTGGCAGGGGAGTGGTGTGG + Intronic
1117340545 14:54788076-54788098 GGGGAGGTGGGAGAGTGCTGAGG - Intronic
1120297739 14:82664999-82665021 GGATTAGTAGGAGTGTGCTGGGG + Intergenic
1122770852 14:104097060-104097082 GGGCTGGAAGGAGGGTGGTGGGG - Intronic
1122874379 14:104656761-104656783 AGGGAGGTAGGAGGGTGCTATGG + Intergenic
1122911046 14:104827691-104827713 GGGGAAGTAGGGGCGTGCAGGGG + Intergenic
1123011546 14:105352240-105352262 GGGGTGGTAGGCACAGGCTGGGG - Intronic
1123687592 15:22810145-22810167 GGGGAGGGAGGAAGGTGCTGGGG + Intronic
1126502571 15:49362304-49362326 GTGGTGGTAGGAGAGTGAAGGGG - Intronic
1127201068 15:56651632-56651654 GGGGAGGTAGGGGCGACCTGTGG - Intronic
1128803999 15:70517338-70517360 GGGGTGGCAGGAGCGGGCACAGG - Intergenic
1128944957 15:71813748-71813770 GGGGTGGGAGGAGAGTGGTGAGG + Intronic
1129210835 15:74066917-74066939 GGGGTGGTAGGAGCATGGTAGGG + Intergenic
1129403176 15:75298412-75298434 GGGGTGGTAGGAGCATGGTAGGG - Intergenic
1129476658 15:75790537-75790559 GGGGTGGTAGGGACATGGTGGGG - Intergenic
1130282287 15:82529971-82529993 GGGGTGGTAGGGACATGGTGGGG - Intergenic
1132484119 16:181365-181387 GGGGTGGTAGGTGAGGGCCGCGG + Intergenic
1132973939 16:2702260-2702282 GCGGTGGCAGGCGCGTCCTGAGG + Intronic
1133209698 16:4256731-4256753 GGGGGGGCAGGGGGGTGCTGGGG + Intergenic
1135629376 16:24023808-24023830 GGTGTGGTAGGAGCTGGCAGAGG - Intronic
1135830419 16:25768044-25768066 GGGGTGGCAGGGGAGTGCGGGGG + Intronic
1137704708 16:50526558-50526580 GGGGTGGTGAGAGAGGGCTGGGG + Intergenic
1138549944 16:57741954-57741976 GGGGTGGAGGGGGCGTGGTGGGG + Intronic
1139268363 16:65660260-65660282 GGGGTGGTAGGATCATGCAGAGG - Intergenic
1139366144 16:66434610-66434632 GGGGTGCTAGGAGGTTGCAGCGG + Intronic
1139558322 16:67726627-67726649 GGGGTGGAAGGAGGGGGCAGTGG + Intronic
1141180393 16:81748984-81749006 GGGGTGGCAGGAGAGAGCTCAGG + Intronic
1142271283 16:89090830-89090852 GGGGTGGAAGGTGTGTGGTGTGG - Intronic
1142355502 16:89599745-89599767 AGGGTGGGAGGAGGGGGCTGGGG - Intergenic
1143078523 17:4365596-4365618 GGGAGGGTAGGAGCGGGCCGCGG - Intronic
1143104269 17:4520494-4520516 GGGGTGGAGAGAGCGCGCTGTGG + Intronic
1143663884 17:8345116-8345138 GGGGTGGTATGAGGGTTTTGTGG + Intronic
1144581929 17:16464015-16464037 GGGGTGGGAGGAGCCTCTTGTGG + Intronic
1144622086 17:16824217-16824239 GGGGTGGGTGGAGCGGGGTGGGG - Intergenic
1144702825 17:17349935-17349957 GGGCTGGGGGGAGCTTGCTGAGG + Intergenic
1144884337 17:18448496-18448518 GGGGTGGGTGGAGCGGGGTGGGG + Intergenic
1145214872 17:21043420-21043442 GGGGAGGCGGGGGCGTGCTGCGG + Intronic
1146222072 17:31032879-31032901 GGGGTGGGGGGCGCGTGGTGGGG - Intergenic
1148793188 17:50184986-50185008 GGGCGGGCAGGAGCGGGCTGAGG + Exonic
1149457304 17:56798240-56798262 GGGGTAGTAAGAGCCTGCAGAGG - Intronic
1150202515 17:63372042-63372064 GGGGAGGAGGGAGAGTGCTGGGG + Intronic
1150927173 17:69545145-69545167 GGGGTGGTGGGGGCGGGGTGTGG - Intergenic
1151219672 17:72603208-72603230 GGGGTAGTAGGAGTGGGGTGGGG - Intergenic
1152249367 17:79203499-79203521 GGGGTGGTTGGAGGGTGAAGGGG + Intronic
1152617276 17:81343697-81343719 GGGGTGCTTGGGGGGTGCTGCGG + Intergenic
1152842208 17:82577402-82577424 GGCGGGGTAGGAGCCTGCTCGGG - Intronic
1154066170 18:11109376-11109398 GGGGTGGCAGGTGGGAGCTGGGG + Intronic
1154954771 18:21242746-21242768 GGGGTGGGACGAGGGAGCTGCGG + Intronic
1155233279 18:23794487-23794509 TGAGTGGTAGGAGTGGGCTGGGG - Intronic
1157198242 18:45637729-45637751 GGCCTGGGAGCAGCGTGCTGGGG - Intronic
1157498512 18:48172904-48172926 GGGGTGGTGGGAGGGGACTGTGG + Intronic
1159169861 18:64752026-64752048 GGGGTGGAGGGAGCTTGCTGGGG - Intergenic
1159289351 18:66396086-66396108 GGGGTGGTGGGGGCGTGGGGAGG - Intergenic
1159684050 18:71394523-71394545 GTGGTGGGAGGAGGGTGCAGGGG - Intergenic
1160033086 18:75279079-75279101 GGGGTGGTGGGAGAATGGTGAGG + Intronic
1160341748 18:78095179-78095201 GGGGTGGGAGGCGGGTGGTGTGG + Intergenic
1160866803 19:1259801-1259823 GGGGTGGAAGGCGCAGGCTGGGG - Intronic
1160918228 19:1507650-1507672 GGGAGGGTAGGAGGGTGTTGGGG + Intronic
1160969852 19:1762717-1762739 GGGATGGTGGGTGCCTGCTGGGG - Intronic
1161101553 19:2424386-2424408 GGGGTGGGAGGAGTGGCCTGGGG - Intronic
1161293923 19:3510076-3510098 GGGGTGGAAGGGACATGCTGGGG - Intronic
1161977348 19:7613773-7613795 GGGGTGGTAGGAGCGTGCTGGGG - Intronic
1162445363 19:10719226-10719248 GGGGTGGTAGGAGGGTAGAGGGG + Intronic
1162786263 19:13036867-13036889 GGGGTGGTAGGAGGGACCTGCGG + Intronic
1162861163 19:13506485-13506507 GGGGCGGGAGGAGGGTGCGGGGG + Intronic
1163359528 19:16837074-16837096 AGGGTGGGAGGAGGTTGCTGTGG + Intronic
1163774420 19:19209548-19209570 GGTGAGGCTGGAGCGTGCTGGGG - Intergenic
1164478539 19:28593705-28593727 GGGGTGGTAGGTGCATTCTGTGG - Intergenic
1165256467 19:34579549-34579571 TGGGTGGTAGGTGAGTGCAGTGG + Intergenic
1166254039 19:41589807-41589829 GGGGTGGGAGGAGAGGGATGAGG - Intronic
1166257260 19:41615355-41615377 GGGGTGGGAGGAGAGGGATGAGG + Intronic
1166270205 19:41708819-41708841 AGGGTGGGAGGAGGGAGCTGGGG + Intronic
1166366468 19:42280820-42280842 GGGTTGGTCGGCGCGGGCTGAGG - Intronic
1166541235 19:43607558-43607580 GGGGTGGGAGGAGGGGGCTGAGG - Exonic
1166781294 19:45344983-45345005 GGGGTGGGAGGAGAGGGCCGAGG - Intronic
1167621105 19:50561287-50561309 GGGGTTGTAGGATCTTGTTGCGG - Intronic
925927245 2:8679165-8679187 GGGGCGGGAGGAGCCTGCGGGGG - Exonic
925984828 2:9207027-9207049 GCGGCGGTCGGAGCCTGCTGCGG + Exonic
926093338 2:10064597-10064619 GGGGTGGTAGGAGGGAATTGGGG - Intronic
928858477 2:35827977-35827999 GGGGTGGTGGGGGGGTGGTGGGG + Intergenic
931376662 2:61713922-61713944 TGGGTGGCAGGAGGATGCTGGGG + Intergenic
932480778 2:72037676-72037698 GGGCTGGGAGCAGCGTCCTGGGG - Intergenic
934663973 2:96157622-96157644 GGGGAGGTAGGAGATGGCTGAGG - Intergenic
935262182 2:101364903-101364925 CGGGTGGGAGGATCGTGATGGGG + Intronic
936705035 2:115062530-115062552 GGGGTGGGAGCAGTGTGCAGGGG - Intronic
945111879 2:206367707-206367729 GGGGTGGCAGGGGGGTGGTGTGG + Intergenic
946152849 2:217787829-217787851 GTGGGGGTAGGAGCATGCTGGGG - Intergenic
947801204 2:232929189-232929211 GGGTGGGTTGGAGCGTGCGGGGG - Intronic
948250842 2:236527634-236527656 GGGCTGGTAGGAGCGGGCCATGG - Intergenic
948607433 2:239145040-239145062 GGCGTGGCAGGAGGCTGCTGAGG + Intronic
948685979 2:239670012-239670034 GGGGTGGTGAGAGCGACCTGTGG + Intergenic
1171089253 20:22268555-22268577 GTGGTGGTAGGGGCGGGGTGGGG - Intergenic
1171999087 20:31758085-31758107 GGGGTGGCAGGAGGGAGGTGAGG - Intronic
1172015534 20:31870556-31870578 GGGGTAGGAGGAGCCTGCGGCGG - Exonic
1173255706 20:41393159-41393181 GGGGTGGAAAGAGGGAGCTGGGG - Intergenic
1173911622 20:46674935-46674957 GGGCTGGGATGAGGGTGCTGTGG + Intronic
1175776347 20:61656235-61656257 GGGTGGGCAGGCGCGTGCTGGGG + Intronic
1175776353 20:61656255-61656277 GGGTGGGCAGGCGCGTGCTGGGG + Intronic
1175776359 20:61656275-61656297 GGGTGGGCAGGCGCGTGCTGGGG + Intronic
1175981618 20:62741521-62741543 GGGGTGGGAGGAACATGGTGTGG - Intronic
1176143014 20:63553496-63553518 GCGGTGGGAGGAGCCTGCTCTGG + Intronic
1177822942 21:26051571-26051593 AGGGAGGTAGGAGTGAGCTGGGG - Intronic
1179826350 21:43968405-43968427 GGGGGAGTAGGCGGGTGCTGGGG + Intronic
1180170943 21:46057836-46057858 GGGCAGGTAGCACCGTGCTGGGG + Intergenic
1180868747 22:19134343-19134365 GAGGTGGGTGGAGCGTGCTGGGG + Exonic
1183382855 22:37499070-37499092 GGGGTGGCGGGAGCGGGGTGGGG - Intronic
1183500610 22:38176521-38176543 TGGGTGGGAGGAGGGTGCTCAGG - Intronic
1183560740 22:38570474-38570496 GCTGTGGAAGGAGCGCGCTGAGG + Intergenic
1183581466 22:38729001-38729023 GGGGCAGCAGCAGCGTGCTGGGG + Intronic
1183956263 22:41382213-41382235 GGGGTGGTCCGCGCGGGCTGGGG + Intronic
1184071967 22:42152242-42152264 GGGGTGAAAGGGGCGTCCTGGGG + Intergenic
1184644063 22:45886566-45886588 GGGCGGGAAGGAGGGTGCTGGGG - Intergenic
1184717529 22:46290460-46290482 GGGCTGGTAGGAGGGTGGCGTGG + Intronic
1184717550 22:46290545-46290567 AGGGTGTTAGGAGGGTGGTGTGG + Intronic
1185390931 22:50561514-50561536 GGGGCGGGAGGAGCGTGGGGCGG + Intronic
949783143 3:7712325-7712347 GGGGCTGTAGGACTGTGCTGGGG + Intronic
952567420 3:34675710-34675732 GGGGTGGGAGGAGAGGGCTAAGG - Intergenic
952643370 3:35625374-35625396 GGGATGGTAGGAGGGAGCTAAGG - Intergenic
953661343 3:44893950-44893972 TGGGGGGTAGGAGAGAGCTGTGG - Intronic
956795733 3:72716971-72716993 GGGGTGGGAGGAGCAGGGTGGGG - Intergenic
960743440 3:120859816-120859838 AGGGTTGCAGGAGCGTGTTGAGG + Intergenic
960989827 3:123303224-123303246 GGGGAGGAAGGAGGGTGATGAGG + Intronic
961384642 3:126516655-126516677 GGGGGGCTAGGAGGATGCTGGGG - Intronic
961475610 3:127144575-127144597 GGGGAGGTGGGAGGGGGCTGTGG + Intergenic
961635098 3:128328269-128328291 GGGGTGGGAGGTGAGTGCAGGGG + Intronic
962069099 3:132014317-132014339 GGGGTGGGAGGAGCATTCGGGGG - Intronic
962714712 3:138116004-138116026 GGGGTGGTGGGTGGGGGCTGCGG - Intergenic
963103031 3:141623651-141623673 GGGGTGGAAGGTGCCTGTTGGGG + Intergenic
963315199 3:143751599-143751621 TGGGAGGTAGGAGGGTGCAGAGG - Intronic
965058340 3:163750003-163750025 GGGGTGGTTGCACTGTGCTGGGG - Intergenic
966525351 3:180913157-180913179 GGGGTCGGAGGAGCGGGCTGAGG - Intronic
968655700 4:1777649-1777671 GGGCTGGGAGGAGCCTCCTGGGG - Intergenic
968664181 4:1811667-1811689 GGGCTAGCAGGAGCGTGCTGGGG - Exonic
968740847 4:2331032-2331054 GGGCTGGAAGGAGGGGGCTGGGG + Intronic
968740865 4:2331081-2331103 GGGCTGGAAGGAGGGGGCTGGGG + Intronic
968801246 4:2744554-2744576 GGGGTGGGAGAAGCCTGGTGGGG - Intronic
968825726 4:2895413-2895435 GTGGTGGGTGGAGGGTGCTGTGG + Intronic
968964505 4:3763211-3763233 GGCGAGGAAGGAGGGTGCTGGGG - Intergenic
969280950 4:6170488-6170510 GTGGTGATAGAAGGGTGCTGGGG - Intronic
970337142 4:15060097-15060119 AGGGTGGTAGCAGGGTTCTGAGG + Intronic
972312163 4:37891420-37891442 GGCGGGGCAGGGGCGTGCTGCGG - Intronic
975617491 4:76261674-76261696 GGGGGGTTAGGAGGGTGTTGAGG + Intronic
975984420 4:80189427-80189449 GGGGTGGGAGGTGCGCGGTGCGG + Intronic
977198953 4:94092507-94092529 GGGAGGGTAGGAGGGTGTTGAGG + Intergenic
977536327 4:98260446-98260468 GTGGTGGTGGGAGCGGGCGGTGG + Intergenic
978741794 4:112145557-112145579 GGGGCGGTAGGAGTTGGCTGCGG + Exonic
980790187 4:137610219-137610241 GAGGAGGTAGGAGCGGGCTGTGG + Intergenic
981782216 4:148442779-148442801 GGGGTGGGGGCAGCGTGCGGAGG - Intronic
982106955 4:152019640-152019662 GGGGTGGTAGGCACGGGCTTTGG + Intergenic
982358415 4:154492644-154492666 GGGGTGGTGGGGGAGCGCTGAGG - Intergenic
983743022 4:171158932-171158954 GTGGTGGGAGGTGCGGGCTGGGG - Intergenic
984739075 4:183141496-183141518 GGGGTGGTAGTAGGGTGCTGTGG - Intronic
985785593 5:1892248-1892270 GAGGTTGTAGGAGGGTCCTGGGG + Intergenic
986671670 5:10148067-10148089 GGTGTGGTGGGAGTGGGCTGTGG - Intergenic
987033361 5:13996293-13996315 GGGGTGGCGGGAGAATGCTGTGG - Intergenic
988504226 5:31807792-31807814 GGGCTGGCAGGAGGGGGCTGGGG + Intronic
994474791 5:100253156-100253178 GGGGTGGTGGGTGGGTGGTGGGG - Intergenic
995185444 5:109266822-109266844 GGGTTGGGAGGAACGTGGTGAGG - Intergenic
996111794 5:119574294-119574316 GGGATGTTGGGAGGGTGCTGAGG - Intronic
997721410 5:136080815-136080837 GGGGAGGCAGGAGGGTGCGGGGG + Intergenic
998543343 5:143004347-143004369 GTGGTGGATGGAGCATGCTGTGG - Intronic
999772450 5:154785835-154785857 GGGGTAGAAGGTGGGTGCTGAGG - Intronic
1000455342 5:161441975-161441997 GGGGTGGGAGGAGGGAGATGGGG + Intronic
1000664678 5:163980199-163980221 GGGGTGGTAGGAGAGGGGTTTGG - Intergenic
1001051452 5:168417741-168417763 GGCCTGGTAGGAGGGTGCTTGGG + Intronic
1003212238 6:4078799-4078821 GGGGTAGCAGGAGGGGGCTGCGG + Intronic
1004473194 6:15947302-15947324 GGGATGGTAGCACCCTGCTGTGG + Intergenic
1005393851 6:25361381-25361403 GGGGTGGGAGGAGTGTGCAGGGG - Intronic
1006030361 6:31173026-31173048 GGGGTGGGAGGAACATGCTTCGG + Intronic
1006155731 6:32011921-32011943 GGGGTGGAAGGGACGTGCTCTGG - Intergenic
1006162062 6:32044775-32044797 GGGGTGGAAGGGACGTGCTCTGG - Intronic
1006183131 6:32165900-32165922 GAGGTGGAGGGAGTGTGCTGGGG + Intronic
1006910824 6:37562457-37562479 GTGGTTCTAGGAGGGTGCTGGGG + Intergenic
1007286231 6:40749458-40749480 GGGGTGGCAGGGGATTGCTGTGG - Intergenic
1011694093 6:89896482-89896504 AGGGTGGTAGGAGGGTGCAGAGG + Intergenic
1012869892 6:104659954-104659976 GGGGTGGTAGGGGAGTGAAGTGG - Intergenic
1013304278 6:108833558-108833580 GGGGTGGGTGGGGGGTGCTGAGG + Intergenic
1013667995 6:112367246-112367268 CAGGTGGCCGGAGCGTGCTGGGG + Intergenic
1014331875 6:120077888-120077910 GGGGTGGGTGGGGCGTGATGTGG + Intergenic
1016038058 6:139403422-139403444 GGGGTGGTGGGGGTGTGGTGGGG + Intergenic
1016060382 6:139623631-139623653 AGGGTGGGAGGAGGTTGCTGTGG - Intergenic
1016863724 6:148746907-148746929 GGAGAGGGAGGAGAGTGCTGCGG + Intergenic
1017383909 6:153861180-153861202 GTGGTGGTGGGTGCGTGTTGTGG - Intergenic
1019164029 6:170087376-170087398 GCGGTGGGAGGAGCGTGGTGTGG + Intergenic
1019164048 6:170087418-170087440 GGGGTGGGAGGAGCGTGGTGTGG + Intergenic
1019164065 6:170087458-170087480 GGGGTGGGAGGAGCGTGGTGTGG + Intergenic
1019164082 6:170087498-170087520 GGGGTGGGAGGAGCGTGGTGTGG + Intergenic
1019164098 6:170087538-170087560 GGGGTGGGAGGAGCGTGGTGTGG + Intergenic
1019164113 6:170087578-170087600 GCGGTGGGAGGAGCGTGGTGTGG + Intergenic
1019164127 6:170087618-170087640 GCAGTGGGAGGAGCGTGGTGTGG + Intergenic
1019164146 6:170087660-170087682 GGGGTGGGAGGAGCGTGGTGTGG + Intergenic
1019164163 6:170087701-170087723 GCGGTGGGAGGAGCGTGGTGTGG + Intergenic
1019164181 6:170087742-170087764 GGGGTGGGAGGAGCGTGGTGTGG + Intergenic
1019164188 6:170087761-170087783 GTGGGGGGAGGAGCGTGGTGTGG + Intergenic
1019164205 6:170087801-170087823 GCGGTGGGAGGAGCATGGTGTGG + Intergenic
1019164224 6:170087843-170087865 GGGGTGGGAGGAGCGTGGTGTGG + Intergenic
1019164242 6:170087884-170087906 GGGGTGGGAGGAGCGTGGTGTGG + Intergenic
1019164260 6:170087925-170087947 GGGGTGGGAGGAGCGTGGTGTGG + Intergenic
1019164275 6:170087967-170087989 GCGGTGGGAGGAGCGTGGTGTGG + Intergenic
1020106334 7:5423863-5423885 GGGGTGGTTGGAGGGGGTTGGGG + Intronic
1024441287 7:49421400-49421422 TGAGTGGTAGGAAGGTGCTGGGG + Intergenic
1026844585 7:73691130-73691152 GGGGTGGCAGGACCTTACTGTGG + Intronic
1027993865 7:85398284-85398306 GGGGTGGTAGGAGCATACTTTGG - Intergenic
1029439084 7:100577450-100577472 GGGGTGGGAGGATCGGGCAGTGG + Intronic
1029602005 7:101571700-101571722 TGGGAAGTAGGAGCCTGCTGTGG + Intergenic
1029664601 7:101987018-101987040 GGGGTGGCAGGAGCAGACTGGGG - Intronic
1029707325 7:102282809-102282831 GGGGTGCTGGGAGCTCGCTGTGG - Intronic
1030727223 7:112939816-112939838 GGGGTAGGAGGAGGGAGCTGCGG + Exonic
1032018379 7:128393611-128393633 GTGGGGGTAGGAGGGTGCTGGGG - Intronic
1032446919 7:131992058-131992080 GGGGTTGTAGGAGACAGCTGGGG + Intergenic
1034276852 7:149827639-149827661 GGTGTGGTTGGAGGCTGCTGTGG + Intergenic
1034822518 7:154230128-154230150 GGGGTTGGAGGAGGGTGCGGAGG - Intronic
1035029205 7:155846405-155846427 GGCTTGGTAGGGGTGTGCTGAGG + Intergenic
1035147630 7:156835795-156835817 GGAGTGGTGGGAGAGTGATGAGG - Intronic
1035268171 7:157703716-157703738 GGAGTGAGGGGAGCGTGCTGAGG - Intronic
1035417469 7:158702463-158702485 GGGGTGGGAGGAGGGTGCTGTGG - Intronic
1040444340 8:47478274-47478296 GGGGTGGTGACAGCGTGGTGGGG + Intronic
1041648742 8:60280945-60280967 GGGGTGCTCGGAGCGCGCAGCGG + Intronic
1042102159 8:65285101-65285123 AGGGTGCTAGGAGTGTGCAGAGG - Intergenic
1043540379 8:81255674-81255696 GGGGAGGAAGGGGCCTGCTGTGG + Intergenic
1043799323 8:84587930-84587952 AGGATGGTAGCAGAGTGCTGTGG + Intronic
1044628550 8:94257536-94257558 GTGGTGTAAGGAGAGTGCTGTGG - Intronic
1046004996 8:108468606-108468628 GGGGTGGTAAGAGAGTGATTTGG - Intronic
1046854859 8:119019507-119019529 GGGGTGGTGGGGGCATGATGTGG - Intronic
1047518774 8:125578394-125578416 GAGCTGGTAGGTGGGTGCTGGGG - Intergenic
1048190152 8:132281028-132281050 GGGGTGGGAGGAGAAAGCTGAGG + Intronic
1048708915 8:137186113-137186135 TGGGTTGTAGGAGTATGCTGAGG - Intergenic
1049545008 8:143226456-143226478 GATGGGGCAGGAGCGTGCTGCGG - Intergenic
1049741385 8:144242718-144242740 GGGGAGCTTGGAGCTTGCTGGGG + Intronic
1049789286 8:144465671-144465693 GGTTTGGAAGGAGCGTGATGAGG + Intronic
1055484498 9:76744485-76744507 GGGATGGTAGGAGGCAGCTGTGG - Intronic
1057741668 9:97717445-97717467 GGGGTGGGAAGAGCTTGCAGGGG - Intergenic
1057942230 9:99295365-99295387 GGGGTGGTAGGAGCCTGGAAAGG + Intergenic
1060757928 9:126226292-126226314 GGGGTTCTTGGAGAGTGCTGGGG - Intergenic
1060936913 9:127521452-127521474 GGGGTGGCAGGAGGCAGCTGGGG - Intronic
1061750254 9:132772150-132772172 GTGGTGGCAGGAGCATTCTGGGG - Intronic
1061870386 9:133517208-133517230 TGGCAGGAAGGAGCGTGCTGGGG - Intronic
1062613443 9:137385412-137385434 GGGCTGGGCGGGGCGTGCTGTGG + Intronic
1186880380 X:13859837-13859859 TGGGTGGTAGGATCGTGTGGGGG - Intronic
1187173108 X:16870465-16870487 GGGGTGGGCGGAGCGTGCCGCGG + Intergenic
1187455891 X:19440950-19440972 AGGGTTGTAGGAGCCTGCTCAGG - Intronic
1188261749 X:28031972-28031994 GGGGTGGTAGTTGTGGGCTGGGG + Intergenic
1193733253 X:85126843-85126865 GGGGTGGGAGGGGTGTGGTGGGG - Intergenic
1193915928 X:87363875-87363897 GGAATGGTAGTAGAGTGCTGAGG + Intergenic
1194040703 X:88938665-88938687 GGGGTGGTGTGACTGTGCTGTGG + Intergenic
1195074755 X:101316030-101316052 GGGGTGGTAGGGGAGTGGAGGGG - Intergenic
1195235042 X:102888726-102888748 GGGGTGGTAGGATGGAGCTGGGG + Intergenic
1195325731 X:103756812-103756834 GGGGTGGTTGGAGCTTGAGGAGG + Intergenic
1196192732 X:112811420-112811442 GTGATGGTAGGAGGGTGATGGGG + Intronic
1196649711 X:118156481-118156503 GGGGTGGGAGGAGGGTGAAGTGG - Intergenic
1196843444 X:119879722-119879744 GTGGTGGTAAGTGCCTGCTGTGG - Intergenic
1198637015 X:138711783-138711805 GGGGTGGGAGGGGCGGCCTGCGG - Intronic
1200208127 X:154332570-154332592 GGCGGGGAAGGATCGTGCTGAGG - Intergenic
1201237855 Y:11928966-11928988 GGAAGGGTAGGAGGGTGCTGAGG - Intergenic