ID: 1161977652

View in Genome Browser
Species Human (GRCh38)
Location 19:7615353-7615375
Sequence CCGCGGTGGCAGACAGGCCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 132
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 121}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161977652_1161977655 -10 Left 1161977652 19:7615353-7615375 CCTTGGCCTGTCTGCCACCGCGG 0: 1
1: 0
2: 1
3: 9
4: 121
Right 1161977655 19:7615366-7615388 GCCACCGCGGACCCCGTGAGCGG 0: 1
1: 0
2: 1
3: 3
4: 63
1161977652_1161977661 20 Left 1161977652 19:7615353-7615375 CCTTGGCCTGTCTGCCACCGCGG 0: 1
1: 0
2: 1
3: 9
4: 121
Right 1161977661 19:7615396-7615418 GCCGATTCCCTGTGATCTGCAGG 0: 1
1: 0
2: 0
3: 5
4: 95
1161977652_1161977663 24 Left 1161977652 19:7615353-7615375 CCTTGGCCTGTCTGCCACCGCGG 0: 1
1: 0
2: 1
3: 9
4: 121
Right 1161977663 19:7615400-7615422 ATTCCCTGTGATCTGCAGGCTGG 0: 1
1: 0
2: 2
3: 21
4: 246

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161977652 Original CRISPR CCGCGGTGGCAGACAGGCCA AGG (reversed) Intronic
900079002 1:841630-841652 CCTCGGTGACACACAGGCCTGGG + Intergenic
901066323 1:6496444-6496466 CCTCGGGGGCAGAGGGGCCAGGG - Intronic
902271499 1:15308358-15308380 CCCCAGTGGCAGCCAGGCCTGGG + Intronic
902272424 1:15314363-15314385 CCCCGGGGGCACACAGACCAGGG + Intronic
904624274 1:31793362-31793384 CCAGGGTGGCAGGCAGGGCAGGG + Exonic
913519379 1:119631237-119631259 CCGCGGTGCCATCCACGCCAGGG - Intronic
920515373 1:206581262-206581284 CAGCGGGAGCAGACAGGCCAGGG + Intronic
920701285 1:208219683-208219705 CCACGGTGGCTGCCAGGCCGAGG - Intronic
921064473 1:211612978-211613000 CCGGCCTGGCAAACAGGCCAAGG - Intergenic
1067755241 10:49000141-49000163 CTGCAGTGGCAGAGGGGCCATGG + Intergenic
1067786509 10:49253465-49253487 CAGGGGTGGCAGACAGGTGAGGG - Intergenic
1068492793 10:57745111-57745133 CTGTTGTGGAAGACAGGCCATGG - Intergenic
1069088778 10:64174231-64174253 CCGCGGTGGGAGACGGACCATGG + Intergenic
1069844481 10:71361741-71361763 CCGCGCTGGCAGGCAGGCCAGGG + Intronic
1073306056 10:102504203-102504225 CCGGGGGGGCAGTCGGGCCAGGG - Exonic
1077177795 11:1198501-1198523 CCCCGGAGCCAGGCAGGCCAGGG - Intronic
1080388898 11:31826293-31826315 CCGGGGTGCAAGCCAGGCCAAGG + Intronic
1083935371 11:65867185-65867207 CTGGGGTGGCAGCCTGGCCAGGG - Intronic
1084432094 11:69116833-69116855 TCGCTGTGGCAGACAGGTGAGGG - Intergenic
1084933864 11:72576710-72576732 CCGCACTGGGAGACAGGCCCAGG - Exonic
1090358992 11:126159904-126159926 CAGTGGTGGCAGATAGGCCCTGG - Intergenic
1091400469 12:177802-177824 CCACGGCAGCAGACAGGGCAGGG + Exonic
1095642710 12:44502823-44502845 CCGCGCTGGCAGGCTGGCCTAGG - Intergenic
1104090547 12:125513098-125513120 CTGCGTAGGCAGGCAGGCCAGGG - Intronic
1105645453 13:22313046-22313068 CCCCACTGGCAGACAGGCCCTGG + Intergenic
1106511786 13:30419377-30419399 CTGTGGTGGCAGACAGGCCTGGG + Intergenic
1107630880 13:42341915-42341937 CCACGATGGCAGAGAAGCCAAGG - Intergenic
1107830057 13:44367128-44367150 CTGAAGTGGCAGACAGGACATGG - Intergenic
1113220228 13:108092465-108092487 CCGCAGTGGCAGAAAGAGCAAGG - Intergenic
1113766311 13:112882901-112882923 CGGGGGTGGCACACAGGACACGG + Exonic
1115525146 14:34272419-34272441 CCTCAGTGGCAGAAAGGCCAAGG + Intronic
1119613065 14:76080168-76080190 CAGCGATGACAGCCAGGCCAAGG - Intronic
1119898806 14:78243051-78243073 CCGGAGGAGCAGACAGGCCAGGG - Intronic
1122072039 14:99211205-99211227 ACGGGGTGCCAGACAGGCCTGGG - Intronic
1122080999 14:99267968-99267990 CCGCTGTGCCAGACAGGGCCAGG - Intronic
1123044132 14:105503219-105503241 CCGGGGTGGGAGGCAGGGCAGGG + Intergenic
1123809792 15:23912376-23912398 GCGCGGGCGCAGACACGCCAAGG + Intergenic
1125674805 15:41496103-41496125 CAGCGGCGGCAGATAAGCCAGGG + Intronic
1131225734 15:90623271-90623293 CAGAGGTGGCAGCCAGGGCATGG - Intronic
1132537304 16:488860-488882 CCGTGATGACAGACTGGCCATGG - Exonic
1132549421 16:548219-548241 CAGCGGCGGCAGACAGACGAGGG + Exonic
1133029673 16:3004428-3004450 CAGCGGTGGCAGCTCGGCCAGGG - Intergenic
1133031804 16:3014563-3014585 CCTTGGTGGCTGTCAGGCCAAGG + Intergenic
1134378782 16:13704475-13704497 CGCAGGTGTCAGACAGGCCAAGG + Intergenic
1134674891 16:16083370-16083392 CTGCTGTGGCACATAGGCCACGG - Exonic
1136382148 16:29900692-29900714 CCGCGGAGGAAGACAGGCTGCGG + Intronic
1141132088 16:81444189-81444211 CCGCAGTGGGAGACAGGGCAGGG + Intergenic
1141997318 16:87643804-87643826 GCGTGGAGGCAGACAGACCATGG - Intronic
1143183434 17:4997689-4997711 CCGCGGGGGCACCCAGGCCCCGG - Intergenic
1143376255 17:6469356-6469378 GCCCGGTGGCACCCAGGCCAGGG - Intronic
1144724521 17:17495151-17495173 CAGCGCCGGCAGCCAGGCCAAGG - Exonic
1145785493 17:27591221-27591243 GAGAGGTGGCAGACAGGCGATGG + Intronic
1148499015 17:48074844-48074866 CCAGGGTGGCAGTCAGGCCGAGG + Intronic
1148732708 17:49847187-49847209 CCAGGGGGGCAGACAGGACAAGG - Intronic
1153285616 18:3452064-3452086 CCGGGGTGGGAGGCGGGCCATGG - Exonic
1161043519 19:2122400-2122422 CCACGGTGGCTTTCAGGCCACGG + Intronic
1161558589 19:4958110-4958132 CCGAGGAGGCAGAGATGCCATGG - Intronic
1161977652 19:7615353-7615375 CCGCGGTGGCAGACAGGCCAAGG - Intronic
1164672032 19:30077698-30077720 CCTGGGTGGCAGAGAGGCCATGG - Intergenic
1166094509 19:40530629-40530651 CCGCGGACGCAGACAGGGGAGGG + Intronic
1167792358 19:51690047-51690069 CTGGGCTGCCAGACAGGCCAGGG + Intergenic
925070624 2:964737-964759 CCGCTGTGGCAGAGTGCCCAGGG - Intronic
925782684 2:7397148-7397170 CCTGAGTGGCAGAAAGGCCATGG + Intergenic
932344735 2:70988280-70988302 CCGCTGGGGCAGGCAGGGCAGGG - Exonic
932442545 2:71746973-71746995 CCTGGGTGGCAGCGAGGCCAAGG + Intergenic
932771737 2:74504185-74504207 CCGTGGAGTCAGACCGGCCAGGG + Intergenic
934763915 2:96869983-96870005 GGGCGGTGGCAGAGAGGCCGCGG - Intronic
948148139 2:235723950-235723972 CCTCAGTGGCAGGCAGGCCCCGG - Intronic
948974310 2:241454128-241454150 CTGGGGTTGCAAACAGGCCATGG - Intronic
1169014731 20:2282396-2282418 CTGCCCAGGCAGACAGGCCAAGG - Intergenic
1170146534 20:13181192-13181214 CCCTGGTGGCAAAGAGGCCAAGG - Intergenic
1172574259 20:35995161-35995183 CCCTGCTGTCAGACAGGCCAAGG - Intronic
1176236408 20:64055790-64055812 CCGCGGCGGGAGCCTGGCCAAGG + Intronic
1176910938 21:14564525-14564547 CAGTGGTGTCAGACAGGCCTGGG - Intronic
1179219071 21:39390387-39390409 CCCGGGTGGCAGACAGCCCTAGG - Intronic
1179491950 21:41746541-41746563 CAGAGGTGACAGACAGGACAGGG - Intronic
1179999697 21:44989800-44989822 CCGCCGTGGCAGACAGCGCGGGG + Intergenic
1180006166 21:45021847-45021869 CCGCGGGAACAGAGAGGCCAAGG + Intergenic
1180007555 21:45029961-45029983 CAGCGGAGGCAGGGAGGCCACGG - Intergenic
1180141157 21:45893972-45893994 CAGAGGTGGCAGCAAGGCCAGGG + Intronic
1180944157 22:19680523-19680545 CTGTGGTGTCAGAGAGGCCAAGG + Intergenic
1183233180 22:36595845-36595867 CCGCTGAGGCGGAAAGGCCAAGG + Intronic
1185314031 22:50171062-50171084 CCGCGGACGCAGCCAGGCCACGG - Intronic
950242212 3:11380862-11380884 CCACAGTGGCAGACAGACGAAGG - Intronic
950373862 3:12554214-12554236 CCGCGCTGGCAGAGAAGGCAGGG - Intronic
950570792 3:13798781-13798803 CAGTGGAGGCAGACAGGCCAAGG - Intergenic
952560151 3:34582819-34582841 CCTCGAAGGCAGAGAGGCCATGG + Intergenic
954152569 3:48664817-48664839 CCACGGAGGCAGACAGGCAGGGG + Intergenic
956458867 3:69451466-69451488 GCACGGTGGTACACAGGCCATGG + Intronic
964451399 3:156816633-156816655 GCGCGGGGGCAGCCCGGCCAGGG - Intergenic
967918768 3:194599002-194599024 CAGCCTTGGCAGCCAGGCCAGGG + Intronic
968878074 4:3284739-3284761 CAGAGGTAGCAGCCAGGCCACGG + Intergenic
969428326 4:7138698-7138720 CCACTGTGGCAGCCAGGCCAAGG - Intergenic
969480403 4:7443902-7443924 CAGCAGCGGCAGCCAGGCCAGGG - Intronic
969491076 4:7499585-7499607 CCGGCATGGGAGACAGGCCATGG + Intronic
971960848 4:33485314-33485336 AGGAGGTGGCAGAAAGGCCATGG - Intergenic
980839001 4:138234014-138234036 GCACTGTGGAAGACAGGCCAAGG - Intronic
984650044 4:182261412-182261434 CCCCTGTGGCAGCCAGGTCAGGG + Intronic
985530875 5:433304-433326 CCTGGGTGGCAGGCAGGCCCTGG - Intronic
991733070 5:69607646-69607668 CTGGGGTGGGAGACAGACCAGGG + Intergenic
991809506 5:70462791-70462813 CTGGGGTGGGAGACAGACCAGGG + Intergenic
991861883 5:71020205-71020227 CTGGGGTGGGAGACAGACCAGGG - Intronic
996520493 5:124420692-124420714 CCTCAGTGGCAGGCAGGGCAGGG + Intergenic
998639767 5:143996224-143996246 GGGAAGTGGCAGACAGGCCAGGG + Intergenic
999758614 5:154683138-154683160 CCGCGGTGGGGGACGGGCGACGG + Intergenic
1002434818 5:179224803-179224825 CTGAGGTGGCAGACAGACCTGGG - Intronic
1007430758 6:41775418-41775440 CGCCGATGTCAGACAGGCCAGGG - Exonic
1011671181 6:89684587-89684609 CTGAGGTGGGAGACAGGCCTGGG + Intronic
1014137781 6:117908046-117908068 CCGCGGGCGCAGAGAGGCCGCGG + Intronic
1017313447 6:153001766-153001788 CGCTGGTGGCTGACAGGCCAGGG - Intronic
1018635687 6:165857318-165857340 CAGAGGTGGCTGAAAGGCCATGG - Intronic
1019605142 7:1906393-1906415 CTGCAGTGGCAGCCAGGCCGGGG - Intronic
1022236678 7:28468141-28468163 CGGCTGTGGCAGACAAGCCGTGG + Intronic
1024210653 7:47200484-47200506 CCGCTGTGGCAGATATGCCTTGG + Intergenic
1025650022 7:63458098-63458120 CCAAGGTGGCAGACAGGCAGAGG + Intergenic
1026174105 7:67980800-67980822 CTGTGGTGGCAGAAAGGACAGGG - Intergenic
1029493100 7:100882874-100882896 CCGGCCAGGCAGACAGGCCAGGG + Intronic
1031927789 7:127654418-127654440 GTGCCGTGGCAGACAGGCCTGGG - Intronic
1034924855 7:155113058-155113080 TCTCTGTGGCAGCCAGGCCAGGG + Intergenic
1035240771 7:157527825-157527847 CCACGGAGGCAGACAGGCTTCGG + Intergenic
1041812524 8:61927531-61927553 CCATGGTGGGAGACATGCCAGGG - Intergenic
1043909090 8:85839706-85839728 ACGTGGTGGCAGACAGGAGAAGG - Intergenic
1047763262 8:127969839-127969861 CCTCTATGTCAGACAGGCCAGGG - Intergenic
1049385019 8:142338806-142338828 CCACGGCTGCAGACAGGGCATGG + Intronic
1055200205 9:73649571-73649593 CAGCAGTGCCGGACAGGCCATGG - Intergenic
1060010045 9:120035956-120035978 CCACTGTGCCAGGCAGGCCAGGG - Intergenic
1060965125 9:127707919-127707941 TCGTGGTGCCAGGCAGGCCATGG + Intronic
1062371672 9:136242449-136242471 CCCTGGGGGCACACAGGCCATGG - Intronic
1203564458 Un_KI270744v1:79938-79960 CCACGGGGCCAGAGAGGCCAGGG + Intergenic
1190301254 X:49058897-49058919 TCCTGGTGGCAGACAGGCAAGGG + Intronic
1192600189 X:72454270-72454292 CCCTGGTGGCAGACAGGAAATGG + Intronic
1201158978 Y:11154557-11154579 CCACGGGGCCAGAGAGGCCAGGG - Intergenic