ID: 1161978331

View in Genome Browser
Species Human (GRCh38)
Location 19:7618191-7618213
Sequence CTTTGAGTCCAGTCCTGCTG TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 219
Summary {0: 1, 1: 0, 2: 3, 3: 15, 4: 200}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161978325_1161978331 17 Left 1161978325 19:7618151-7618173 CCAACCGTGTCTGGGTGGGGCTG 0: 1
1: 0
2: 1
3: 17
4: 170
Right 1161978331 19:7618191-7618213 CTTTGAGTCCAGTCCTGCTGTGG 0: 1
1: 0
2: 3
3: 15
4: 200
1161978317_1161978331 28 Left 1161978317 19:7618140-7618162 CCTGTCTGTCCCCAACCGTGTCT 0: 1
1: 0
2: 3
3: 15
4: 143
Right 1161978331 19:7618191-7618213 CTTTGAGTCCAGTCCTGCTGTGG 0: 1
1: 0
2: 3
3: 15
4: 200
1161978324_1161978331 18 Left 1161978324 19:7618150-7618172 CCCAACCGTGTCTGGGTGGGGCT 0: 1
1: 0
2: 0
3: 6
4: 104
Right 1161978331 19:7618191-7618213 CTTTGAGTCCAGTCCTGCTGTGG 0: 1
1: 0
2: 3
3: 15
4: 200
1161978327_1161978331 13 Left 1161978327 19:7618155-7618177 CCGTGTCTGGGTGGGGCTGGAGT 0: 1
1: 0
2: 1
3: 35
4: 313
Right 1161978331 19:7618191-7618213 CTTTGAGTCCAGTCCTGCTGTGG 0: 1
1: 0
2: 3
3: 15
4: 200
1161978323_1161978331 19 Left 1161978323 19:7618149-7618171 CCCCAACCGTGTCTGGGTGGGGC 0: 1
1: 0
2: 1
3: 7
4: 178
Right 1161978331 19:7618191-7618213 CTTTGAGTCCAGTCCTGCTGTGG 0: 1
1: 0
2: 3
3: 15
4: 200

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161978331 Original CRISPR CTTTGAGTCCAGTCCTGCTG TGG Exonic
900154326 1:1198005-1198027 CTTTCAGGCCAGTGCTGGTGTGG - Intergenic
900712977 1:4126775-4126797 CCTTGAGGCCAGTGCTGTTGTGG + Intergenic
900995436 1:6121039-6121061 CTCTGAACCCAGGCCTGCTGAGG + Intronic
903577139 1:24346066-24346088 CTTGGGGTCCAGTCCTGCTGCGG - Intronic
906685528 1:47760936-47760958 CCTTCATCCCAGTCCTGCTGTGG - Exonic
906906134 1:49894151-49894173 CTCCCAGTCCAGTACTGCTGTGG - Intronic
909764399 1:79337430-79337452 CTTTGAGGCCAGTCCAGCCAAGG + Intergenic
913288538 1:117250450-117250472 GTTTGATTTCAGTCCTGCTCTGG + Intergenic
917098412 1:171422739-171422761 CTTTGAATCCAGTCTGGGTGTGG + Intergenic
917904047 1:179572077-179572099 CTTTCCGACCAGTCCTGGTGAGG + Intronic
918234882 1:182570972-182570994 CTTTGGGTTCACTCCTGCTGTGG + Intergenic
920210686 1:204326109-204326131 CCACGTGTCCAGTCCTGCTGTGG + Intronic
920214171 1:204350479-204350501 CTCTGAGCCCAGCCCTGCGGAGG - Intronic
920835355 1:209505815-209505837 CTATAAGTACAGTCCTGCTTTGG + Intergenic
922338066 1:224633741-224633763 CACTGAGTGCAGTCCTGGTGGGG - Intronic
923720080 1:236459400-236459422 CTTTGAGGCCAGGCATGCTCAGG - Intronic
1064256340 10:13745738-13745760 CTCTGAGACCTGTCCTGTTGTGG - Intronic
1064271489 10:13870197-13870219 CCCAGAGGCCAGTCCTGCTGTGG + Intronic
1065848643 10:29767847-29767869 ATTTGAGGACTGTCCTGCTGTGG + Intergenic
1068341095 10:55704167-55704189 CTTTGAGTCCACTGCTACTTTGG - Intergenic
1069061120 10:63895446-63895468 CTGTGAATCCAGTCCAGCTCAGG - Intergenic
1069563318 10:69446781-69446803 CTGTGAGTCAAGTCCTGCCCAGG - Intergenic
1072483501 10:95831710-95831732 GTTTGGGTTCAGCCCTGCTGGGG + Intronic
1075849519 10:125575569-125575591 CTCTGAGCCAAGTCCTGTTGGGG - Intergenic
1076096619 10:127738331-127738353 CTTTCTTCCCAGTCCTGCTGTGG + Intronic
1076731092 10:132439246-132439268 CTTTCAGTCCAGGGCTTCTGAGG - Intergenic
1077174304 11:1181674-1181696 CTTGGACGCCAGGCCTGCTGGGG - Intronic
1078526218 11:12103573-12103595 CCTGGAGCCCAGTCCTGCTGGGG + Intronic
1080016252 11:27509764-27509786 CTTAGCTTCCAGTGCTGCTGAGG - Intergenic
1081639136 11:44740742-44740764 CTTTAAGTCCAGTCTTGGTTTGG + Intronic
1081846356 11:46243403-46243425 CTGGGAGTTGAGTCCTGCTGCGG + Intergenic
1081848893 11:46261066-46261088 CTTGGAGTCCAGTGCTGGTTAGG - Intergenic
1082232310 11:49782312-49782334 CTCTGATTCCTGTCCTGATGTGG - Intergenic
1084145709 11:67264174-67264196 CTTTGAGTCGGGTCCTGTGGTGG + Intergenic
1085226942 11:74930128-74930150 CCTCGATTCCAGTCCTGCTCTGG - Intronic
1085512619 11:77095966-77095988 CTTTGCCTCCTGTGCTGCTGTGG + Intronic
1085697444 11:78717038-78717060 CTCTGTGTCCAGCCCTGCTCAGG - Intronic
1086618320 11:88851637-88851659 CTCTGATTCCTGTCCTGATGTGG + Intronic
1087364439 11:97201403-97201425 CTTTGAGGGCACTCCTTCTGTGG + Intergenic
1087709358 11:101531387-101531409 CTTTGGGTCCAGACTTCCTGGGG - Intronic
1088024666 11:105163448-105163470 CTTTTACTCCAGGCCTCCTGTGG + Intergenic
1090386983 11:126363083-126363105 CATTCAGTCCAGCCCAGCTGGGG - Intronic
1090688537 11:129152704-129152726 CTTTTATTCCAGTTTTGCTGAGG - Intronic
1091300219 11:134502703-134502725 CTTTGAGGAGAGTCCTGGTGGGG - Intergenic
1093487395 12:19666322-19666344 CTTTGAGGTCTGCCCTGCTGGGG + Intronic
1096372047 12:51076895-51076917 CTTTGCTTCCAATCCAGCTGGGG + Intronic
1096783088 12:54001904-54001926 CTTGGAGTTCAACCCTGCTGAGG - Intronic
1099108713 12:78529061-78529083 CTCTGAGTCCTATCCTGCTATGG - Intergenic
1100535479 12:95504958-95504980 CTGTCAGTCCAGTCCTCCTCTGG + Intronic
1102402732 12:112644342-112644364 ATTGGAGTTCAGTCCTGCTGGGG + Intronic
1102815394 12:115861100-115861122 CTAAGAGCCCAGGCCTGCTGTGG + Intergenic
1103274044 12:119697000-119697022 GTTTGAGTCCAATCCTGTTCAGG + Intronic
1103917310 12:124382574-124382596 CTTTGAGTCCAGCCCTGGATGGG + Intronic
1103937424 12:124483927-124483949 ATTGGAGTCCTGCCCTGCTGTGG - Intronic
1110407846 13:75170433-75170455 CTTTGAGTGCTGTCCAGCTGAGG - Intergenic
1111981592 13:95021858-95021880 CATTCAGCCCAGCCCTGCTGAGG - Intronic
1113461065 13:110482547-110482569 CTTTGAGTCCAGGCATGCCTTGG - Exonic
1113878981 13:113612157-113612179 CTTTCTGTCCAGTGCTGGTGCGG + Intronic
1116207575 14:41887696-41887718 CATTGCTTCCAATCCTGCTGGGG + Exonic
1122914745 14:104853518-104853540 CTCTGGGTCCAGTTCAGCTGTGG + Intergenic
1202885618 14_KI270722v1_random:104306-104328 ATTTGAGAACACTCCTGCTGTGG - Intergenic
1202885636 14_KI270722v1_random:104498-104520 ATTTGAGAACACTCCTGCTGTGG - Intergenic
1124129814 15:26973544-26973566 CTCTGAGTCCCTTCCTGCTGTGG + Intronic
1125421379 15:39508062-39508084 CTTTGCGGCCACTCCTGTTGGGG + Intergenic
1127264655 15:57351753-57351775 CTTTAAGTCCAGGCCTCATGAGG - Intergenic
1127532028 15:59852705-59852727 ATTGGAGCTCAGTCCTGCTGGGG + Intergenic
1128604095 15:69022852-69022874 GCTTGAGTCCAGTCCAGTTGTGG - Intronic
1129478414 15:75803492-75803514 CCTTCAGTCCAGCCCTCCTGGGG - Intergenic
1129836502 15:78710812-78710834 CCTTCAGTCCAGCCCTCCTGGGG - Intronic
1130250084 15:82294369-82294391 CTTTGAGGCCGGCACTGCTGGGG + Intergenic
1130306349 15:82714390-82714412 CTTTGAGTCAAGGTCTGATGAGG + Intergenic
1131415079 15:92248207-92248229 ATTTGAGTGCAGTGTTGCTGTGG - Intergenic
1133522349 16:6571278-6571300 ACTGGATTCCAGTCCTGCTGTGG - Intronic
1134249790 16:12566272-12566294 GTCTCTGTCCAGTCCTGCTGTGG - Intronic
1134674895 16:16083384-16083406 TTCTGAATCCAGGCCTGCTGTGG - Exonic
1135385726 16:22037864-22037886 CTTTGAGCCCAATCCTTTTGGGG + Intronic
1135921045 16:26649285-26649307 CTTGGGGTTCAATCCTGCTGGGG - Intergenic
1137548741 16:49422186-49422208 CTAAGAGTCCAGGCCTCCTGAGG - Intergenic
1139925103 16:70481627-70481649 GTCTGGGTCCAGTCCTGCTCTGG - Intronic
1141018842 16:80475928-80475950 CTTGGAGTCCAGTCTTGCTGAGG + Intergenic
1142078387 16:88133466-88133488 CTCTGAGTCCAGGCCTGACGCGG + Intergenic
1144703527 17:17353297-17353319 CTGTGTGGCCAGGCCTGCTGGGG + Intergenic
1145018656 17:19414189-19414211 CTTTGGGTCCAGCCCTAGTGGGG - Intronic
1148576077 17:48712250-48712272 GTTGGATTCAAGTCCTGCTGTGG - Intergenic
1148652385 17:49259613-49259635 CTTAGCCTCCAGTCCTGATGGGG + Intergenic
1151280143 17:73067700-73067722 TTTTGAGTCCATTCATGCTATGG + Intronic
1151652195 17:75476966-75476988 GCTTGGGTCCAGTCCTGCTCTGG - Intronic
1153990511 18:10394950-10394972 GTTTGTGTCCCGTCCTGCTAGGG + Intergenic
1154121628 18:11657036-11657058 CATTGAGTCCAGAGCTGCTTTGG + Intergenic
1155814601 18:30289726-30289748 CTTGGAGCCCAGCCTTGCTGTGG + Intergenic
1158679107 18:59550528-59550550 TTTTGAGTCCAGTCCACTTGAGG - Intronic
1160056528 18:75487375-75487397 AGTTGATTCCACTCCTGCTGGGG + Intergenic
1160695854 19:483947-483969 CTGTGAGATCAGTCCTGGTGTGG + Intergenic
1161978331 19:7618191-7618213 CTTTGAGTCCAGTCCTGCTGTGG + Exonic
1165433083 19:35783462-35783484 ATTTGAGTCAAGACCTGCAGAGG + Intronic
1167154301 19:47729045-47729067 GTTCCAGTCCTGTCCTGCTGGGG + Intronic
1202661020 1_KI270708v1_random:71331-71353 ATTTGAGAACACTCCTGCTGTGG - Intergenic
925565535 2:5250076-5250098 CATTCAGTCAAGGCCTGCTGTGG - Intergenic
927918940 2:26956569-26956591 CTTTGATTCCTTTACTGCTGAGG + Intergenic
928027374 2:27751418-27751440 CTCTGACTCCAGGCCGGCTGTGG + Intergenic
929999181 2:46849481-46849503 TATTCAGTCCACTCCTGCTGGGG - Intronic
933589532 2:84216608-84216630 CTATAACTCCAGTCATGCTGGGG - Intergenic
936909028 2:117571733-117571755 CTGTGTGTGCAGTCATGCTGTGG + Intergenic
937005633 2:118510242-118510264 CTCTGAGTCCAGTTCTCTTGTGG - Intergenic
937135023 2:119544708-119544730 CTTTCATTCCACTCCTGCTAAGG - Intronic
937508414 2:122563608-122563630 CCTTGAGTGCAGTCTTGCAGGGG + Intergenic
938289741 2:130142869-130142891 CTCTGAGTCCTGACATGCTGGGG - Intronic
940065002 2:149617553-149617575 CCCTGAGACCAGACCTGCTGGGG + Intergenic
946007023 2:216533909-216533931 CTTTGCTTCCAGGCTTGCTGTGG + Intronic
946752287 2:222904467-222904489 TTGTGAGTCCATTCATGCTGTGG + Intronic
947637996 2:231689805-231689827 CTTTGAGCCAAGTTCTGCTGTGG - Intergenic
1169296270 20:4402698-4402720 TTTTGAGTCCAGGCATGCTAAGG - Intergenic
1169765225 20:9141361-9141383 CTTTTTGTCCAGTTCTTCTGTGG + Intronic
1170446595 20:16434314-16434336 CATTGAGCCGAGTCCTCCTGTGG - Intronic
1171421902 20:25023160-25023182 CTGTGTGTGGAGTCCTGCTGCGG - Intronic
1172046587 20:32084734-32084756 CTTTGAGACCAGTCCTGTAGTGG + Intronic
1173033811 20:39389328-39389350 CTATGAGTCAATTTCTGCTGGGG + Intergenic
1173303621 20:41827384-41827406 ATTCTAGTCCTGTCCTGCTGGGG + Intergenic
1173518445 20:43681854-43681876 CTGTGAGTACAGTCCTGCTGTGG + Exonic
1175538472 20:59732590-59732612 CTTTGAGTTAAGGGCTGCTGAGG + Intronic
1176200518 20:63858305-63858327 CCCTGAGTCCAGGGCTGCTGGGG + Intergenic
1180328504 22:11454880-11454902 ATTTGAGAACACTCCTGCTGTGG - Intergenic
1181306476 22:21920016-21920038 CTCTGAGCCCAGGCCTGCAGGGG - Exonic
1181411230 22:22721227-22721249 CTTTGTTCACAGTCCTGCTGGGG - Intergenic
1181631177 22:24152170-24152192 CCTTGAGTCGATCCCTGCTGTGG + Intronic
1181715457 22:24724019-24724041 CTTTGTTTCAAGTCTTGCTGTGG - Intronic
1181892577 22:26076727-26076749 CTGTGAGTCCAGTACTGATCTGG - Intergenic
1181973449 22:26711259-26711281 CAATGAGCTCAGTCCTGCTGGGG + Intergenic
1182038339 22:27216738-27216760 CTTGGAGCACAGTCCTGCTGGGG - Intergenic
1184124729 22:42479144-42479166 CTCCGAATCCAGTCCTGTTGGGG - Intergenic
1184944978 22:47796435-47796457 CTTGGACTCCAGCACTGCTGAGG + Intergenic
950224196 3:11220381-11220403 CTGTGAGAACAGTACTGCTGAGG + Intronic
950514396 3:13454697-13454719 CCTTTAGTCCAATCCTCCTGTGG - Intergenic
951333953 3:21398889-21398911 CTTGGAGCCCAGGGCTGCTGAGG + Intergenic
954381050 3:50219305-50219327 CTTGGAGTCCAGTGATCCTGGGG - Intronic
954416411 3:50395571-50395593 CCTTGAGTCCAGGCCTGATATGG + Intronic
954460551 3:50624413-50624435 CTTTGACACCGGCCCTGCTGAGG - Intronic
954795291 3:53158288-53158310 CTATGAGTCTAGCCCTGCTCAGG + Intronic
957092841 3:75749223-75749245 CTTCCAGACCACTCCTGCTGTGG + Intronic
960506700 3:118502755-118502777 GGCTGAGTCCAGGCCTGCTGGGG + Intergenic
960676908 3:120204064-120204086 CAAGGACTCCAGTCCTGCTGTGG - Intronic
965045739 3:163574163-163574185 CTGCAAGTCCAGTCATGCTGTGG - Intergenic
967286677 3:187878196-187878218 CTCAGAGTCCAGTCATGCAGAGG + Intergenic
970205512 4:13651732-13651754 CTTTGAGCCAGGTACTGCTGTGG - Intergenic
973613492 4:52658674-52658696 TTTTGAGTTCAGTCCTTCCGAGG - Intronic
973829767 4:54747095-54747117 CTTGGATTCCAGTCCTGCCTTGG - Intergenic
975174728 4:71275129-71275151 CTTTGGGTTCACTCCTGCTGTGG - Intronic
978501450 4:109414423-109414445 CCTTGAGTCCAGTCGTGAAGGGG - Intergenic
980238778 4:130145408-130145430 CTTTGAGTCCATACCTGTTTTGG + Intergenic
982117643 4:152110924-152110946 CTCTGAGTCCAGTTGTGCTCAGG - Intergenic
982717088 4:158820350-158820372 CTTTGAGACCAGTTCTAGTGTGG - Intronic
983826154 4:172263781-172263803 CTTTGAGTTTAATCCTGGTGGGG + Intronic
985198329 4:187457284-187457306 CTTTTAGTGCAGTGCTTCTGTGG + Intergenic
986749722 5:10776144-10776166 TGTGGAGTCCACTCCTGCTGTGG - Intergenic
988410951 5:30885086-30885108 CTTTGAGTCCCTTCCAGCTGTGG + Intergenic
989576384 5:42992192-42992214 CTGTCAGGCCAGTGCTGCTGCGG - Intergenic
997397449 5:133575215-133575237 GTTTGAGTCTAGTCCTGATGTGG - Intronic
998146809 5:139733836-139733858 GTTTAAGTCCAGTCTTGCTCTGG + Intergenic
999192801 5:149761049-149761071 CTTGGGGTCTAATCCTGCTGCGG + Intronic
999983025 5:156976050-156976072 CTTTGACACCAGGCCAGCTGTGG + Intergenic
1000949432 5:167462633-167462655 CTTTGAGAGGAGTTCTGCTGGGG - Intronic
1001668483 5:173453727-173453749 CTTGGAGCTCCGTCCTGCTGGGG - Intergenic
1001939898 5:175733039-175733061 TTTTCTGTCCAGTCCCGCTGGGG - Intergenic
1002961084 6:1915407-1915429 CTTGGAGTCCTGCCCTGCTCAGG - Intronic
1006363279 6:33599483-33599505 CTTTGGGTCCAGTCCAGCAAGGG - Intergenic
1008005082 6:46401950-46401972 CTTTGCATCCAGGCCTGCTTAGG - Intronic
1009899329 6:69792741-69792763 CTTTGTGTCAAGTACTGCTGAGG - Intronic
1010020688 6:71156345-71156367 CTCTGAGTCCAGTGATGGTGGGG - Intergenic
1014098186 6:117482610-117482632 CTTTCAGCCCAGCCCTGCGGGGG - Intronic
1018217211 6:161540093-161540115 GCTTGGGTCCAGTCCAGCTGGGG - Intronic
1019912707 7:4110403-4110425 GTTTGGGTCCAGTCCTTCTGTGG + Intronic
1024981437 7:55160797-55160819 CTTTGAGTCAAGTGCTGGTCTGG + Intronic
1025306676 7:57867759-57867781 CTTTGAGTTCAATCATGATGGGG + Intergenic
1026276703 7:68885123-68885145 CTTCAAGTACAGTCATGCTGGGG + Intergenic
1026459522 7:70601395-70601417 CTTTGTGTCCAGTCCTGTGCAGG + Intronic
1028924446 7:96342260-96342282 CTATAAGTCCAGTGCTGCTTGGG - Intergenic
1032709749 7:134451354-134451376 CTTAGAGTCCCGTGCTGATGAGG - Intronic
1034311010 7:150087720-150087742 CTGTGAGCTCAGTCCTGTTGAGG - Intergenic
1034795840 7:154012917-154012939 CTGTGAGCTCAGTCCTGTTGAGG + Intronic
1035414414 7:158670858-158670880 CTTTGAGTGCTGTTCTGCTATGG - Intronic
1036165500 8:6429252-6429274 CTTTGAGTCCAGAGCTTCTCAGG + Intronic
1041739469 8:61142645-61142667 CATTGAGTCCTGGCCTTCTGGGG + Intronic
1041762302 8:61379716-61379738 CTTTGGGTCCACACCTGTTGGGG + Intronic
1047550816 8:125870554-125870576 CTGTGAGACCAGTCTTGCAGTGG + Intergenic
1048810399 8:138280587-138280609 CTTAGAGTTCAGTAGTGCTGTGG + Intronic
1048816546 8:138339814-138339836 TTTGGAGTCCAGCCCTGCAGAGG - Intronic
1049337140 8:142092501-142092523 CCTTGGGTCCTGCCCTGCTGGGG - Intergenic
1049567307 8:143347837-143347859 CTTCGAGGCCTGGCCTGCTGTGG - Intronic
1051384739 9:16495513-16495535 ATTTGGGTCCGGTCCTTCTGGGG + Intronic
1052198980 9:25754657-25754679 CTTGGAGTCCAGCACTGCTTCGG + Intergenic
1053250578 9:36571185-36571207 CTTTGAAGGAAGTCCTGCTGTGG + Intergenic
1053288664 9:36865882-36865904 CTTTGTGCCCAGCCCTGCTCTGG - Intronic
1053443309 9:38132937-38132959 CTTTGTGATCAGTCCTGCTGAGG - Intergenic
1054986873 9:71271749-71271771 CTTTGTGTCCAGGGCTGCTGAGG - Intronic
1055306529 9:74935098-74935120 CTTTCCCTGCAGTCCTGCTGAGG + Intergenic
1056655186 9:88503161-88503183 TCTGCAGTCCAGTCCTGCTGTGG - Intergenic
1056722944 9:89087133-89087155 CTTTAATTCCAGTTCTCCTGTGG - Intronic
1057752641 9:97804575-97804597 CTTTGAGGCCAGTCCTCCCCAGG + Intergenic
1059898376 9:118894232-118894254 CTTCAATTCCAGACCTGCTGTGG + Intergenic
1060878278 9:127099095-127099117 CATGGGGTCCAGTCCCGCTGTGG - Intronic
1061389500 9:130309735-130309757 CCCTGGGTCCAGTCCTGCAGGGG - Intronic
1062355041 9:136157955-136157977 CTCTGAGGCCAGCCCTGCCGGGG + Intergenic
1185516376 X:701987-702009 CTTCCAGTCCATTGCTGCTGTGG + Intergenic
1187221190 X:17327733-17327755 ATTGGAGCTCAGTCCTGCTGGGG - Intergenic
1189693453 X:43639798-43639820 CTGTCAGTCCCGTCTTGCTGAGG - Intergenic
1190240493 X:48654452-48654474 CTTTGCCTCCAGACCTACTGGGG + Intergenic
1190745923 X:53321511-53321533 CCTTGGGGCCAGTCCAGCTGCGG - Intergenic
1191106025 X:56772848-56772870 CTATGATCCCAGTCCTCCTGTGG + Intergenic
1191107018 X:56778250-56778272 CTATGATCCCAGTCCTCCTGTGG + Intergenic
1191108569 X:56787989-56788011 CTATGATCCCAGTCCTCCTGTGG + Intergenic
1191109394 X:56793252-56793274 CTGTGATCCCAGTCCTCCTGTGG + Intergenic
1193012066 X:76687646-76687668 CTTTCAGTCCAGTCCTACGAAGG + Intergenic
1193862929 X:86693508-86693530 CTTTTACTCCAGTCCTGAAGAGG - Intronic
1197896879 X:131325465-131325487 ATTTGACTCCAGTCCTCCAGGGG + Intronic
1197951301 X:131900374-131900396 CTATGAAGCTAGTCCTGCTGAGG - Intergenic
1198636025 X:138701321-138701343 CTTTGTATCTGGTCCTGCTGAGG + Intronic
1199694654 X:150335322-150335344 CTTAGTGTCCAGGTCTGCTGGGG + Intergenic
1199987805 X:152964886-152964908 CCTTGTTTCCAGTCCTGCAGAGG + Intronic
1202092376 Y:21207371-21207393 CTTTTATTCCAGTGCTACTGCGG - Intergenic