ID: 1161979627

View in Genome Browser
Species Human (GRCh38)
Location 19:7623811-7623833
Sequence TGTTGAGGAGCAGGGGCCGC CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 391
Summary {0: 1, 1: 0, 2: 1, 3: 25, 4: 364}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161979621_1161979627 18 Left 1161979621 19:7623770-7623792 CCACTCGTGCACGTGGTGTGGGT 0: 1
1: 0
2: 0
3: 1
4: 47
Right 1161979627 19:7623811-7623833 TGTTGAGGAGCAGGGGCCGCCGG 0: 1
1: 0
2: 1
3: 25
4: 364

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161979627 Original CRISPR TGTTGAGGAGCAGGGGCCGC CGG Exonic
900380286 1:2380666-2380688 TCCTGAGGAGCTGGGGCCACAGG + Intronic
900462655 1:2808960-2808982 TGTGGAGGAGCTGGGGCTGCCGG + Intergenic
900650313 1:3727183-3727205 TGATGATGAGGATGGGCCGCCGG - Exonic
900986934 1:6078568-6078590 TGTTGGGGAGAAGGGGATGCAGG + Intronic
901771954 1:11535096-11535118 TGCTGAGGAGCACGGGCAGCAGG - Exonic
901790391 1:11650757-11650779 TGCTGAGGAGGAGCGGCCGGAGG - Exonic
902074140 1:13769204-13769226 GGCAGAGGAGCAGGAGCCGCTGG - Intronic
902546412 1:17193346-17193368 TGTGGAGGAGGAAGGGCTGCAGG + Intergenic
902623998 1:17666428-17666450 TTTTGAGGAGCAGGGGCCTGGGG + Intronic
902756555 1:18552882-18552904 TGTGGAGGGGCAGGGACAGCTGG - Intergenic
903173102 1:21565609-21565631 AGATGAGGAGGGGGGGCCGCAGG + Intronic
903568306 1:24285332-24285354 TGTTCTGGAGCAGAGGCCACTGG + Intergenic
903866756 1:26404587-26404609 TCTTGAGTAGCTGGGGCTGCAGG - Intergenic
904002555 1:27347275-27347297 TGTGGAGGAGCTCGGGCTGCTGG - Intronic
904690950 1:32292785-32292807 TGTTGAGGGGCTGGGGCCGTGGG + Intronic
905483011 1:38274613-38274635 TGGTGAGGAGCTGGGGCTGGGGG + Intergenic
906057791 1:42929978-42930000 TGCTCAGCAGCAGGGGCCACAGG + Exonic
906713478 1:47950332-47950354 TGTTCAGAAGCATGGGCAGCAGG + Intronic
906902785 1:49854611-49854633 TGTGGAGGTGCAGGAGCAGCTGG - Intronic
908165189 1:61450552-61450574 TGATGAGGAGCTGGGCCTGCAGG + Intronic
908573359 1:65433167-65433189 TGTTGAGGAGTAGGGGTGGGGGG - Exonic
909452058 1:75809020-75809042 TCTTGAGTAGCAGGGACCACAGG + Intronic
909695587 1:78465125-78465147 TGATGAAGAGCAGGGGGCACGGG + Intronic
913328598 1:117649315-117649337 TGATGAGGAGCTGAGGCCTCTGG - Intergenic
913971868 1:143422582-143422604 TGGTGAAGAGCAAGGGCTGCAGG + Intergenic
914066247 1:144248195-144248217 TGGTGAAGAGCAAGGGCTGCAGG + Intergenic
914112906 1:144718159-144718181 TGGTGAAGAGCAAGGGCTGCAGG - Intergenic
914459250 1:147867594-147867616 TGTTGTGGAGTGGGGGCCTCGGG + Intergenic
916210685 1:162357271-162357293 TGTTGGGGAGTGGGGGCAGCGGG + Intronic
918127460 1:181596960-181596982 TGTGGAGGAGAAGGGGCTGAGGG + Intronic
922658883 1:227411471-227411493 TTTTGAAGAGCAGGGGGAGCGGG - Intergenic
922766534 1:228159137-228159159 GGCTGAGGAGAAGGGGTCGCAGG - Exonic
922984991 1:229859458-229859480 TGTGGACGAGAAGGTGCCGCAGG - Intergenic
923382414 1:233434736-233434758 TCTTGAGGAGCAGGGACTACAGG + Intergenic
923429244 1:233905022-233905044 ACTTGAGGCGGAGGGGCCGCGGG - Exonic
924264174 1:242264438-242264460 TCTTCAGGAGGAAGGGCCGCTGG + Intronic
1062951792 10:1508954-1508976 TGCTGAGGCCCAGGGACCGCTGG - Intronic
1063363996 10:5478846-5478868 TGTTGAGGAGCCAGGGCAGGGGG + Intergenic
1063437707 10:6048107-6048129 AGTTGAGGGTCAGGGGCCACGGG - Intronic
1063583018 10:7326400-7326422 TATTGATGGGCAGGTGCCGCTGG - Intronic
1064564542 10:16626307-16626329 TCCTGAGGAGCTGGGGCCACAGG + Intronic
1065039019 10:21671827-21671849 TCCTGAGGAGCTGGGGCCACAGG - Intronic
1067204078 10:44198852-44198874 TGGTGAGGAACAGCTGCCGCTGG + Intergenic
1067686489 10:48468999-48469021 TGTTAAAGAGCAGGGGCCAAGGG + Intronic
1067842132 10:49689233-49689255 TGTGGAGGAGCAGGGGCAGAGGG + Intronic
1068029024 10:51684741-51684763 TCTTGAGTAGCTGGGGCCACAGG - Intronic
1069645043 10:69989486-69989508 TGCTGAGTAGCTGGGGCCACAGG - Intergenic
1072716336 10:97755267-97755289 GGTTCAGGAGCAGAGGCCGCAGG - Intronic
1074148752 10:110739992-110740014 TGCTGAGTATCAGGGGCAGCTGG - Intronic
1075475114 10:122727671-122727693 CCTTGAGGAGGAGGGGCCGCGGG + Intergenic
1076047431 10:127305860-127305882 CATGGAGGAGCAGGGGTCGCTGG - Intronic
1077048268 11:555571-555593 TGGGGCGGGGCAGGGGCCGCGGG + Intronic
1077266595 11:1653786-1653808 GGGTGAGAAGCAGGGGCCACCGG - Intergenic
1077281429 11:1747926-1747948 GGCTCAGGGGCAGGGGCCGCCGG + Exonic
1077307995 11:1876454-1876476 TGGTGAAGAGCAAGGGCTGCGGG - Intronic
1077430866 11:2515453-2515475 TGCTGGGCAGCAGGGGCCTCGGG - Intronic
1077584232 11:3438418-3438440 TCTTGAGTAGCTGGGGCCACAGG + Intergenic
1082182259 11:49133787-49133809 TGAAGAGGAGCAGAGGCTGCTGG - Intergenic
1082841141 11:57690843-57690865 TGTTGTGGGGCAGGGGGAGCGGG + Intronic
1083663694 11:64263737-64263759 TGTAGATGAGCAGGGCCGGCAGG - Exonic
1083996476 11:66275568-66275590 TGTTGAGGTGTTGGGGCAGCTGG + Intronic
1084014269 11:66369397-66369419 TGAAGAGCAGCAGGGGCAGCTGG + Exonic
1084241132 11:67821070-67821092 TCTTGAGTAGCTGGGGCCACAGG + Intergenic
1084272461 11:68036605-68036627 TATTGGGCAGCAGGGGCTGCGGG - Exonic
1084410430 11:69003399-69003421 GGCTGAGGAGCAGGGGCAGGAGG + Intergenic
1084445315 11:69200345-69200367 TGGTGGGGAGCAGGGGCGCCGGG + Intergenic
1084756309 11:71241006-71241028 TGCTGAGGAGGAGGGGCCCAGGG + Intronic
1084831313 11:71771553-71771575 TCTTGAGTAGCTGGGGCCACAGG - Intergenic
1085041670 11:73330571-73330593 TGTGGAGGGGCAGGGGCAGAGGG + Intronic
1085269854 11:75263835-75263857 TGTTGAGGTGCAGGAGGCTCGGG + Intergenic
1085739935 11:79069947-79069969 TGTGGAGGAGCGCGGGCCGGAGG - Exonic
1086683252 11:89701159-89701181 TGAAGAGGAGCAGAGGCTGCTGG + Intergenic
1088504799 11:110517108-110517130 AGTTGAGGTGCAGGGGCAGTGGG + Intergenic
1089647037 11:119887096-119887118 TTTTGAGGAACACGGGCAGCTGG + Intergenic
1089691503 11:120189522-120189544 CGTTGAGGAGCATGGGCGGTGGG + Intergenic
1092276125 12:7062145-7062167 TTTTGAGTAGCAGGGACCACAGG - Intronic
1092926676 12:13278379-13278401 TGCAGGGGAGCAGGGGCCGCTGG + Intergenic
1093497951 12:19779348-19779370 TGGTGATGAGCAGGGGCCTTGGG + Intergenic
1095976864 12:47946212-47946234 TGTTGAAGAGTAGGGGCGGTGGG - Intergenic
1096846535 12:54410224-54410246 TGCTGTGGAGCAGGGGCAGGAGG + Intronic
1097289028 12:57898317-57898339 CGTTTAGGAGTAGGAGCCGCTGG + Intergenic
1097875257 12:64637178-64637200 TGTTGAGCAGCAGGCGCCTTGGG + Intronic
1098477845 12:70926229-70926251 TGTTGTGGGGCAGGGGGAGCAGG - Intergenic
1100576543 12:95896770-95896792 TGTAGTGGAGCAAGGGCAGCAGG - Intronic
1102488002 12:113271151-113271173 TCTTGAGTAGCAGGGACCACAGG - Intronic
1102491437 12:113291726-113291748 GGCTGAAGAGCAGGGGCAGCTGG - Intronic
1103190098 12:118993877-118993899 TCTTGAGTAGCTGGGGCTGCAGG - Intronic
1103559870 12:121788019-121788041 TCCTGAGGAGCTGGGGCCGCAGG + Intronic
1103928651 12:124437547-124437569 TGCCGGGCAGCAGGGGCCGCAGG - Intronic
1105478912 13:20755269-20755291 TGTGGAGATGCAGGGGCTGCTGG + Intronic
1105512443 13:21061641-21061663 CGCGGAGGAGCAGGGGCCGCAGG - Intergenic
1105617617 13:22033731-22033753 TTTCCAGGAGCAGGGGCGGCGGG - Intergenic
1106523815 13:30522234-30522256 TCTTGAGTAGCTGGGACCGCAGG + Intronic
1106717883 13:32409815-32409837 TGTAGGGGAGAAGGGGCTGCAGG + Intronic
1106774176 13:32992346-32992368 TGTGGAGTAGCTGGGACCGCAGG - Intergenic
1107966880 13:45605089-45605111 AGTTGAGGGGGAGGGGCCTCGGG - Intronic
1110889887 13:80685998-80686020 TCTTTAGGAGCAGGGACCTCTGG + Intergenic
1112032800 13:95473014-95473036 TGTTGAGTAGCTGGGACCACAGG - Intronic
1113859474 13:113471896-113471918 TGGTGATGAGCAGGGGCTGCTGG + Intronic
1114792437 14:25674694-25674716 GGTTGAAGAGCAGGGGCAACAGG + Intergenic
1117668028 14:58077481-58077503 TCTTGAGTAGCTGGGACCGCAGG - Intronic
1117699217 14:58396320-58396342 GGCTGAGGAGCAGGGCACGCAGG + Exonic
1117816541 14:59604853-59604875 TGATGAGGATCAGGGGCACCTGG - Intronic
1118911886 14:70068499-70068521 TCTTGAGTAGCTGGGGCCACGGG + Intronic
1119635239 14:76268002-76268024 TGTCGGGGAGCCGGGGCCGGGGG + Intergenic
1120626312 14:86831401-86831423 TGTTGAGATGCAGGGGCTGTTGG - Intergenic
1120875058 14:89367926-89367948 TGGTGAGGAGCATGGGATGCTGG - Intronic
1121659040 14:95620995-95621017 TGATGGGGAGCAGGTGCCGTCGG - Intergenic
1121871681 14:97413935-97413957 CGACGAGGAGCAGGGGCCGGGGG - Intergenic
1122271897 14:100572044-100572066 GGCTGAGGAGCAGGTGCCTCTGG - Intronic
1122374063 14:101247085-101247107 GGATGAGGGGCAGGGGCGGCTGG - Intergenic
1122449844 14:101796840-101796862 ACTTGAGGAGCAGAGGCAGCAGG - Intronic
1122817433 14:104320637-104320659 TGATGAGGGGAAGGGGCCGTGGG - Intergenic
1122817443 14:104320663-104320685 TGATGAGGGGAAGGGGCCGTGGG - Intergenic
1123868442 15:24547058-24547080 TCTTGAGCAGCTGGGGCCACAGG + Intergenic
1124404349 15:29380641-29380663 TGCTGAGGAGCAGGCCACGCGGG - Intronic
1125727059 15:41873554-41873576 GGTGGAGGAGAAGCGGCCGCTGG - Exonic
1126392798 15:48177924-48177946 TCCTGAGGAGCAGGTGCAGCTGG - Intronic
1128074554 15:64818141-64818163 AGGTGAGGAGCAGGGGCCTTTGG + Intronic
1128516271 15:68343961-68343983 GGGTGAGCAGAAGGGGCCGCGGG + Intronic
1129108457 15:73324068-73324090 TGGTGAGGGGGAGGGGCCACAGG - Exonic
1129221283 15:74133198-74133220 TGTTGATGCGCAGGGAACGCAGG - Exonic
1129278373 15:74462624-74462646 TCTTGAGGAGCTGGGGCTACAGG + Intergenic
1129289699 15:74555451-74555473 TTTTGAGTAGCTGGGGCCACGGG + Intronic
1129452865 15:75660385-75660407 TGGTGCAGAGCAGGGGCCGATGG - Exonic
1129464353 15:75715648-75715670 AGTTGAGGAGCAGGCACAGCTGG - Intergenic
1129672537 15:77615228-77615250 TGTTGAGGTGCCGGAGCCTCAGG + Exonic
1129720895 15:77877364-77877386 AGTTGAGGAGCAGGCACGGCTGG + Intergenic
1130333661 15:82940767-82940789 TCCTGAGTAGCTGGGGCCGCAGG - Intronic
1131511300 15:93050919-93050941 TGGGGAGGTGCAGGGGCCGTGGG + Intronic
1131795664 15:96013631-96013653 TCTTGAGTAGCTGGGACCGCAGG - Intergenic
1131824143 15:96303921-96303943 TCTGTAGGAGCAGGGGCCACCGG - Intergenic
1132554165 16:565360-565382 AGGTGAGGGGCAGGGGCTGCAGG - Exonic
1132568225 16:632848-632870 TGTGGAGGTGCAGGCCCCGCAGG - Exonic
1132572181 16:648978-649000 AGGTGTGGAGCAGGGGCCTCTGG + Intronic
1132594312 16:741203-741225 GGTTGGGGTGCAGGGGGCGCAGG + Intronic
1133000837 16:2850648-2850670 AGTCGAGGAGCAGGGGCAGAGGG + Intergenic
1133352614 16:5111975-5111997 TCTTGAGTAGCTGGGGCCACAGG + Intergenic
1134298883 16:12971636-12971658 TCTTTAGGAGCAGGGGCTGTAGG + Intronic
1134511784 16:14854456-14854478 TGTTGAGTAGCTGGGACCACAGG + Intronic
1134689608 16:16182645-16182667 TTTTGAGGAGCAGTGGGAGCTGG + Intronic
1134699427 16:16252955-16252977 TGTTGAGTAGCTGGGACCACAGG + Intronic
1134775892 16:16853218-16853240 TGTAGGGGAGAAGGGGCCACAGG + Intergenic
1134972402 16:18541716-18541738 TGTTGAGTAGCTGGGACCACAGG - Intronic
1135569143 16:23535008-23535030 TGTTGAGGAGCAGGGGCAGGTGG + Exonic
1135615906 16:23910840-23910862 TGTTGGTTACCAGGGGCCGCAGG - Intronic
1136596959 16:31257491-31257513 TGTTGAGTAGCTGGGACCACAGG + Intergenic
1137060886 16:35791023-35791045 TGCTGAGAAGCAGGAGCCCCTGG - Intergenic
1137061287 16:35793532-35793554 TGTTGAGAAACAGGAGCCCCTGG - Intergenic
1137594498 16:49714848-49714870 GGCTGGAGAGCAGGGGCCGCGGG - Intronic
1138114294 16:54348232-54348254 TGTTGAGTAGCTGGGGCTACAGG + Intergenic
1138229509 16:55326942-55326964 TGTTGTGGGGCAGGGGGCGGGGG + Intronic
1139797851 16:69497635-69497657 TGTTTAGGAGCTGGGGCTGGTGG - Intergenic
1141538398 16:84699713-84699735 AGGTGAGGAGCCGGGCCCGCCGG + Intergenic
1141609223 16:85171633-85171655 TGTATAGGAACAGGGGCAGCCGG - Exonic
1141737106 16:85861050-85861072 GGTTGGGGAGCAGAGGCTGCAGG + Intergenic
1142108217 16:88317596-88317618 GGTTGAGGGGCAGTGCCCGCCGG + Intergenic
1142253791 16:89004081-89004103 GGCCGAGGGGCAGGGGCCGCAGG + Intergenic
1142364059 16:89640451-89640473 AGTCGAGGAGCAGGGGGCTCCGG + Intergenic
1142809565 17:2388973-2388995 TGTCCAGGTGCAGGGCCCGCAGG + Intronic
1143053252 17:4143757-4143779 TGTTGAGGTGCGGAGGCCGTGGG + Exonic
1143524558 17:7464497-7464519 TGGTGGTGAGCAGGGGCCTCAGG + Intronic
1143749973 17:9021218-9021240 CGTGGGGGAGGAGGGGCCGCCGG - Intergenic
1144482509 17:15639531-15639553 TGTTGAGAAGCCAGGGCAGCAGG + Intronic
1144721961 17:17477147-17477169 GGTTGAGGCGCAGGGACCGGCGG - Exonic
1144916173 17:18725500-18725522 TGTTGAGAAGCCAGGGCAGCAGG - Intronic
1146211248 17:30945404-30945426 TGTTGAGAAGCAGGGTCCCGGGG - Intronic
1147140070 17:38455706-38455728 TGGGGAGGAGCAGGGGCTTCTGG + Intronic
1147330853 17:39698592-39698614 AGTTGAGAAACAGGGGCCTCTGG - Intronic
1147449504 17:40495422-40495444 GGTTGGGGAGCAGGGGCAGAGGG - Intronic
1147627229 17:41908007-41908029 TCAGGTGGAGCAGGGGCCGCAGG + Intronic
1147733608 17:42619731-42619753 TGTGGAGTAGCAGGGACCACAGG - Intergenic
1147889101 17:43704640-43704662 TGTCGAGGTGCAGGGACCCCAGG + Intergenic
1149296273 17:55265027-55265049 CGCTGGGGAGCAGCGGCCGCCGG + Exonic
1150399563 17:64846495-64846517 TTTTGAGGAGCAGAGGCAGGAGG + Intergenic
1151794125 17:76331623-76331645 TGCTGAGGAGCCGGGGAAGCGGG + Intronic
1152556351 17:81055067-81055089 GGTGGAGGAGCCGGGGGCGCCGG - Intronic
1152634888 17:81426890-81426912 GGGGGAGGAGCTGGGGCCGCTGG - Exonic
1152941239 17:83173813-83173835 TGCTCAGGAGCAAGGGCTGCAGG + Intergenic
1155768904 18:29672454-29672476 TGTTGAGGAGTAGGGGCTGGGGG - Intergenic
1158029322 18:52943871-52943893 TCCTGAGCAGCTGGGGCCGCAGG + Intronic
1159385580 18:67721367-67721389 TGTTGTGGGGTAGGGGCAGCGGG + Intergenic
1160406784 18:78651797-78651819 AGGTGGGGAGCTGGGGCCGCTGG + Intergenic
1160723701 19:608465-608487 TGATGGGGAGCAGGGGACCCTGG + Intronic
1161385459 19:3989707-3989729 TCTTGAGTAGCTGGGGCCACAGG - Intergenic
1161443725 19:4306355-4306377 TGTTGAGTAGGAGGGGCGGGGGG - Intronic
1161481673 19:4513813-4513835 TTTTGAGGAGGTGGGGCCTCTGG - Intronic
1161595924 19:5150994-5151016 TGTTGAGGGGCAGAGCCCGTGGG + Intronic
1161864483 19:6824059-6824081 TCCTGAGGAGCTGGGGCCACGGG + Intronic
1161979627 19:7623811-7623833 TGTTGAGGAGCAGGGGCCGCCGG + Exonic
1162094362 19:8301967-8301989 TTTTTGGGAGCAGGGGCAGCAGG - Intronic
1162744753 19:12792123-12792145 GGTGGAGGTGCAGGGGGCGCAGG + Exonic
1163249468 19:16117880-16117902 TGTTGGGGAGCAAGGGACTCAGG + Intronic
1163561336 19:18021171-18021193 CATTGAGGGGCAGGGGCGGCTGG + Intergenic
1163779927 19:19240684-19240706 TGGTGAGTGGCAGGGGCTGCGGG + Exonic
1163850258 19:19658975-19658997 TGTTGCTGAGGAGGGGCCACAGG + Intronic
1164161097 19:22625800-22625822 TGTTCAAGGGCAGGGGCCGAGGG - Intergenic
1164624982 19:29721350-29721372 TGTTTGGGAGCAGGGGCTGGGGG - Intergenic
1164683377 19:30150651-30150673 TGTGGAGGGGCAGGGACCCCGGG - Intergenic
1164699004 19:30269171-30269193 TGTTGAGTAGCAGTGGTCCCTGG + Intronic
1165017391 19:32890910-32890932 TGTGGAGATGCAGGGGCTGCTGG - Intronic
1165075661 19:33278752-33278774 TGGGGAGGAGCAGGGGCTGCAGG - Intergenic
1165328231 19:35126395-35126417 AGTGGAAGAGCACGGGCCGCTGG + Exonic
1165689927 19:37855393-37855415 TGCTGTGGAGCAGGAGCTGCCGG - Intergenic
1165850865 19:38849716-38849738 GGTGGAGGAGCCGGGGCGGCGGG - Exonic
1166587654 19:43964988-43965010 TGAGGAGGAGCTGGGGCTGCTGG + Exonic
1166590264 19:43991586-43991608 TGAGGAGGAGCTGGGGCTGCTGG + Exonic
1166593839 19:44027061-44027083 TGAGGAGGAGCTGGGGCTGCTGG + Exonic
1166597223 19:44060493-44060515 TGAGGAGGAGCTGGGGCTGCTGG + Exonic
1166606583 19:44148809-44148831 TGAGGAGGAGCTGGGGCTGCTGG + Exonic
1166620950 19:44299672-44299694 TGAGGAGGAGCTGGGGCTGCTGG - Exonic
1166624730 19:44340482-44340504 TGAGGAGGAGCTGGGGCTGCTGG - Exonic
1166939840 19:46355926-46355948 GGGTAAGGAGCAGGGGCTGCAGG + Intronic
1166982297 19:46638662-46638684 TGCTGGGGAGCGGGGGACGCTGG - Intergenic
1167270009 19:48501262-48501284 TGGTGAGGACCACGGGCCGCGGG - Exonic
1167299619 19:48671259-48671281 TGTCGAGGGGCAGGGGGCCCTGG + Intronic
1167772715 19:51530961-51530983 TGGTGAGGAGATGGGGACGCAGG + Intronic
925212211 2:2059454-2059476 TGTTGATGAGCAGAGCCCCCTGG + Intronic
925286770 2:2721300-2721322 TGTGGAGGTGCAGGTGCCGATGG - Intergenic
925286861 2:2721640-2721662 TGTGGAGGTGCAGGTGCCGATGG - Intergenic
925611317 2:5705612-5705634 GGTGGAGGAGCAGGGGAAGCAGG + Intergenic
926231477 2:11007433-11007455 TGTTGAGAAGGAGAGGCTGCAGG + Intergenic
927191658 2:20521202-20521224 TCTTGAGAAGCTGGGGCCACAGG - Intergenic
931116936 2:59175084-59175106 TCTGGAGGAGCAGCGGCAGCGGG - Intergenic
931586870 2:63839432-63839454 TCTCGAGTAGCTGGGGCCGCAGG - Intergenic
931702865 2:64923185-64923207 GGTTGAGGAGCATGGGCAGGAGG + Intergenic
932450917 2:71810346-71810368 GGTAGAGGAGCAGGGACCCCTGG - Intergenic
932573152 2:72948771-72948793 GGATCAGGAGCAGGGGCCCCAGG + Intronic
932929076 2:76012433-76012455 TGTTGTGGAGTAGGGGGAGCGGG - Intergenic
934085328 2:88504537-88504559 TCTTGAGTAGCTGGGACCGCAGG - Intergenic
934176559 2:89583514-89583536 TGGTGAAGAGCAAGGGCTGCAGG + Intergenic
934286869 2:91657875-91657897 TGGTGAAGAGCAAGGGCTGCAGG + Intergenic
935238993 2:101161942-101161964 TGGTGAGGAGGAGGGTCCCCTGG + Intronic
938078129 2:128352621-128352643 TGGTGAGGTGGAGGGGCCTCAGG + Intergenic
939552178 2:143628557-143628579 TGTAGAGGAGAAGGAGCCTCAGG - Intronic
941476179 2:165953891-165953913 TGTAATGGAGCAGGGGCGGCGGG + Intergenic
941672338 2:168308570-168308592 TCTTGAGTAGCAGGGACCACAGG + Intergenic
942512508 2:176717524-176717546 TGTGAAGGAGCAAGGGCAGCAGG + Intergenic
944255902 2:197623600-197623622 TCTTGAGTAGCTGGGACCGCAGG + Intronic
944772187 2:202925660-202925682 TGCTGAGTAGCAGGGGGAGCTGG + Intronic
945094034 2:206202582-206202604 TCTTGAGTAGCTGGGGCTGCAGG + Intronic
946037500 2:216755599-216755621 GGTTGAGGAGGAGAGGCCGTGGG + Intergenic
948126422 2:235567675-235567697 TGGTGGGGAGAAGGGGCTGCAGG + Intronic
948526065 2:238571588-238571610 TGTTGTGGAGCTGGGCCAGCTGG - Intergenic
948725135 2:239929846-239929868 GGCTGAGGAGCAGGGGCAGTGGG - Intronic
948733171 2:239979999-239980021 TGTAGGGGAGCAGGCGCCACAGG - Intronic
1170465825 20:16621696-16621718 TCTTGAGTAGCTGGGACCGCAGG - Intergenic
1171083534 20:22213737-22213759 TGCTGAGAAGCAGTGGCAGCCGG - Intergenic
1172673361 20:36649659-36649681 TCTTGAGGAGCAGGGACTACAGG - Intergenic
1174017794 20:47502409-47502431 TGCTAAGGAGCCGGGGCAGCAGG - Intronic
1174801496 20:53566660-53566682 TCTTGAGTAGCTGGGGCCACAGG + Intergenic
1175968722 20:62673195-62673217 TGATGGGGAGCAGGGGGTGCAGG + Intronic
1176000179 20:62828158-62828180 TGTGCAGGAGTAGGGGCCTCAGG + Intronic
1176108383 20:63400002-63400024 GAGTGAGGAGCAGGGGCGGCTGG - Intergenic
1176117267 20:63438549-63438571 TGTTGAGGAGTGGAGGCCGCTGG - Intronic
1176285085 21:5015237-5015259 TGTTGAGGGGCGGGGGCAGCTGG - Intergenic
1176309835 21:5143606-5143628 TCCTGAGGAGCTGGGGCCACAGG - Intronic
1178350028 21:31866212-31866234 AGTTGACCAGCAGGGGGCGCCGG + Intergenic
1178966438 21:37123870-37123892 TCTTGAGTAGCTGGGGCCACAGG + Intronic
1179847221 21:44118426-44118448 TCCTGAGGAGCTGGGGCCACAGG + Intronic
1179872096 21:44248238-44248260 TGTTGAGGGGCGGGGGCAGCTGG + Intronic
1180867936 22:19130114-19130136 TGTTTGGGAGCAGAGGCGGCAGG - Intergenic
1181641809 22:24205003-24205025 TGCTGAGTAGCAGGGACTGCAGG + Intergenic
1181653068 22:24271419-24271441 AGCGGAGGAGCAGGGGCCACAGG + Intronic
1183165062 22:36141274-36141296 TGCTGAGGAGCTGAGGCGGCAGG - Exonic
1183932814 22:41245935-41245957 TGTCCAGGAGCAGGAGCTGCTGG - Exonic
1183950646 22:41350875-41350897 TGTCGTGGAGCAGGGGCCATAGG + Intronic
1184160090 22:42692746-42692768 TGTTGAGGAGCTGTGGGAGCAGG - Exonic
1184520451 22:44990978-44991000 TGTGGAGGAGCCGCGGCAGCAGG - Intronic
1184655458 22:45939700-45939722 TCTTGAGGAGCTGGGACCACAGG - Intronic
1184726668 22:46351242-46351264 TCCTGAGGAGCTGGGGCCACAGG - Intronic
1185221213 22:49630091-49630113 TGTGGACGCACAGGGGCCGCGGG - Intronic
952836174 3:37604111-37604133 TGATGAGGAGCAGGGGTTGGAGG - Intronic
953032331 3:39186907-39186929 TGTGGACCAGCAGGGGCTGCTGG - Exonic
954136107 3:48582913-48582935 GGGTGAGGAGCAGGGGTAGCAGG + Intronic
955276996 3:57556296-57556318 AGCTGAGGAGCCGAGGCCGCCGG - Exonic
956760884 3:72443520-72443542 TGTGGAGGTTCAGGGGCAGCAGG - Intronic
957056598 3:75447945-75447967 TCTTGAGTAGCTGGGGCCACAGG + Intergenic
960937267 3:122911815-122911837 TGGTGGGGAGCAGGGGGCACAGG - Intronic
961241727 3:125417222-125417244 TCTTGAGGGGAAGGGGCAGCTGG - Intergenic
961380502 3:126493557-126493579 TGTTGAGTGCCAGGGGCCGTGGG + Intronic
961660001 3:128463558-128463580 TGGTGAGGAGCTGGGGGCGGGGG - Exonic
964475362 3:157092885-157092907 TTATGAGGAGCAGGGACCTCAGG + Intergenic
965759067 3:172055680-172055702 TCGTGAGGAGCAGGGGCAGTGGG + Intronic
968054186 3:195678579-195678601 TGTGGAGGAGAGGGAGCCGCAGG + Intergenic
968483714 4:848887-848909 GGTGGAGGACCAGGGGCCCCTGG - Intergenic
968920440 4:3519556-3519578 TGTTCTGGAGCAGGAGCCGCTGG + Intronic
968999410 4:3968249-3968271 TCTTGAGAAGCTGGGGCCACAGG + Intergenic
969814486 4:9676667-9676689 TCTTGAGTAGCTGGGGCCACAGG - Intergenic
971418302 4:26453472-26453494 TGGGCAGGAGCAGGGGCAGCAGG + Intergenic
972419246 4:38870805-38870827 TGTTTCTGAGCAGGGGCTGCTGG - Intronic
979363314 4:119790386-119790408 TGTTGAGTAGCTGGGGTCACGGG + Intergenic
980074542 4:128280719-128280741 TCTTGAGTAGCTGGGGCCACAGG + Intronic
982660861 4:158205154-158205176 TGTTGAGTAGCTGGGACTGCAGG - Intronic
984260835 4:177442279-177442301 TGTTGACGACCAGGGGCAGAGGG + Exonic
985129627 4:186726659-186726681 AGTTGAGGAGTTGCGGCCGCCGG + Intronic
985619727 5:947928-947950 TGTTGAGGTGGAGGGGTGGCGGG - Intergenic
988576912 5:32435040-32435062 TCTCGAGGAGCAGGGACCACAGG + Intronic
989287707 5:39721585-39721607 TGTGGAGGCGGCGGGGCCGCTGG - Intergenic
989420014 5:41226620-41226642 TGGTGGTTAGCAGGGGCCGCAGG - Intronic
991932268 5:71765530-71765552 CGGTGAGGAGCAGGGGAAGCAGG + Intergenic
992563254 5:77972944-77972966 AGGCGAGGAGCAGGGGCTGCGGG - Intergenic
994498575 5:100544236-100544258 TCTTGAGTAGCTGGGGCCACAGG - Intronic
996748241 5:126864573-126864595 TGTTGAGTAGCTGGGTCCACAGG + Intergenic
997065659 5:130556008-130556030 TGGTGAAGAGCAGGGGCGGCAGG - Intergenic
1000338531 5:160259773-160259795 TGTCGGGGAGCAGGGGAAGCAGG + Intronic
1002386939 5:178875411-178875433 TGGTGAGGAGCAGGAGGAGCTGG + Intronic
1002390877 5:178910661-178910683 TGTTGAGGTGCATGGGCCAGCGG - Intronic
1003108218 6:3231402-3231424 TGTTTAGTCGCAGGGGCTGCGGG + Intronic
1003117412 6:3292612-3292634 TGTGGAGGCACAGGGGCTGCAGG - Intronic
1004634581 6:17454460-17454482 TGTTTGGGAGCAGAGGCTGCAGG - Intronic
1005875403 6:30007029-30007051 AGTAGCGGAGCAGGGTCCGCAGG - Intergenic
1005991570 6:30906106-30906128 TCTTGAGCAGCTGGGACCGCAGG + Intergenic
1007335678 6:41153660-41153682 TCTTGAGGAGTGGGGGCCCCTGG - Intronic
1007415938 6:41691237-41691259 TGTGGATGAGAAGGGGCAGCAGG + Intronic
1010019214 6:71139789-71139811 TGTTGAGGAGCAGGGGGTCAAGG - Intergenic
1010404916 6:75493797-75493819 TGTTGAGGAGCTGAGCTCGCGGG + Intergenic
1010914760 6:81602484-81602506 TGTTGAGGGGTAGGGGGCACAGG - Intronic
1011063201 6:83294762-83294784 TATTGAGGAGCAGGGGGAGTCGG - Intronic
1011700711 6:89951700-89951722 TGTTCAGGAGCTGGGTCTGCAGG + Exonic
1012618422 6:101307007-101307029 TGTTGAGTAGCTGGGGCTGTAGG + Intergenic
1012815483 6:104017934-104017956 TGTTTTGGGGCAGGGGCCGGAGG - Intergenic
1013783183 6:113751197-113751219 TCCTGAGGAGCTGGGGCTGCAGG - Intergenic
1014380634 6:120736641-120736663 TCTTGAGTAGCTGGGACCGCAGG + Intergenic
1016824828 6:148378476-148378498 TCCTGAGTAGCTGGGGCCGCAGG + Intronic
1016916386 6:149247905-149247927 TGTTGAGGGGTAGGGGCAGCGGG + Intronic
1017564970 6:155674018-155674040 TGTTGTGGGGCAGGGGGAGCGGG + Intergenic
1018154481 6:160973146-160973168 TGGAGAGGAGCAGGGGCAACCGG - Intergenic
1018870778 6:167780541-167780563 AGCTGAGCAGCAGGGGCCGGCGG + Intergenic
1018974838 6:168556400-168556422 TGGGGAGGTGCGGGGGCCGCAGG - Intronic
1019392846 7:799096-799118 TGGTCAGGAGCAGAGGCCCCTGG - Intergenic
1019486098 7:1290020-1290042 TGCTTAGGAGCAGGCGCGGCTGG + Intergenic
1019524849 7:1476305-1476327 AGCTGAGCAGCAGGGGCAGCCGG + Exonic
1019658366 7:2209926-2209948 TGGTGAGAAGCTGGGGCCACGGG - Intronic
1020238598 7:6374897-6374919 TGTCGCGGGGCGGGGGCCGCGGG + Intronic
1021106630 7:16645822-16645844 TGCCGAGGAGGAGGAGCCGCAGG + Intergenic
1021716688 7:23468732-23468754 GGTTGGGGAGCAGGGTCCGCTGG + Intronic
1024981477 7:55161087-55161109 TGCAGAGGAGCAGGTGCTGCTGG - Intronic
1026942501 7:74295336-74295358 AGTTGAGAAGCTGGGGCAGCAGG + Intronic
1027345385 7:77254239-77254261 TGTTGGGGACCACGGGCCTCGGG - Intronic
1027394674 7:77742084-77742106 TTTTGGGGAGCTGGGGCCGGAGG + Intronic
1028525669 7:91783188-91783210 GGGTGAGGAGAAGGGGCTGCAGG - Intronic
1029191048 7:98772591-98772613 TGTTGAGTAGGAGGGGCCTGTGG - Intergenic
1029702307 7:102255109-102255131 TGGTGAGGAGCACAGGCCGCCGG - Exonic
1032239964 7:130153092-130153114 TGCGGAGGAGCAGAGGCCCCTGG + Intergenic
1032458495 7:132092364-132092386 TGGTGAGGAGCAGAGGCCCTCGG - Intergenic
1033067259 7:138168011-138168033 TTTTGATGAGCAGGGGCCTAAGG + Intergenic
1033670269 7:143485815-143485837 TCTTGAGGAGCTGGGACCACAGG + Intergenic
1033731803 7:144187675-144187697 TCTGGAGGAGCAGGGACAGCAGG - Exonic
1033742651 7:144286258-144286280 TCTGGAGGAGCAGGGACAGCAGG - Intergenic
1033751251 7:144363356-144363378 TCTGGAGGAGCAGGGACAGCAGG + Exonic
1035752130 8:2003142-2003164 TGGTGGGGAGTCGGGGCCGCTGG + Exonic
1036293602 8:7517444-7517466 TCTGGAGGAGCTGGGGCCACAGG + Intergenic
1036328959 8:7803551-7803573 TCTGGAGGAGCTGGGGCCACAGG - Intergenic
1036786666 8:11692624-11692646 GGCTGAGGCGCAGAGGCCGCGGG - Intronic
1038041417 8:23727049-23727071 TGTTGACGACGCGGGGCCGCCGG + Intergenic
1039900090 8:41745548-41745570 TGGTGAGGTGCAGAGGCTGCTGG + Intronic
1040621983 8:49101549-49101571 GGTTTAGGAGCAGAGGCCACTGG + Intergenic
1041377104 8:57216014-57216036 GGTGGAGGGGCGGGGGCCGCAGG + Intergenic
1042661781 8:71162321-71162343 TGTTTGGGAGCAGGGGTAGCTGG + Intergenic
1045137321 8:99234519-99234541 GGTTGGGGTTCAGGGGCCGCAGG + Intronic
1045717000 8:105058521-105058543 TGTCGTGGGGCAGGGGACGCGGG + Intronic
1047025185 8:120815989-120816011 TGCTGAGGACCAGGGGCTACTGG + Intergenic
1047464013 8:125094973-125094995 TCCTGAGGAGCTGGGGCTGCAGG + Intronic
1048270362 8:133023317-133023339 TGATGGGGAGCAGGGTCAGCTGG + Intronic
1049061476 8:140279552-140279574 TGATGAGGACCAGGGGCTGGAGG - Intronic
1049204471 8:141357287-141357309 TGATGACCAGCAGGGGCAGCAGG + Exonic
1049372621 8:142274967-142274989 TGCAGAGGAGCAGAGGCTGCAGG + Intronic
1049607617 8:143536968-143536990 TGTTGAGGCGCATGGGCACCCGG - Intronic
1049622522 8:143605066-143605088 TGCTAAGGAGCAGGAGCTGCTGG - Exonic
1049761366 8:144333207-144333229 TGTGGCGGCGCAGGAGCCGCGGG + Exonic
1050231155 9:3526651-3526673 TGTGGAGGAGCGCGGGCGGCGGG + Intergenic
1050666143 9:7938597-7938619 TGTTGTGGAGCAGAATCCGCAGG - Intergenic
1052776158 9:32734879-32734901 TGTTGTGGGGCAGGGGGAGCGGG + Intergenic
1053023391 9:34710730-34710752 TCTTGAGGAGCTGGGACCACAGG + Intergenic
1053348174 9:37393529-37393551 TCTCGAGTAGCTGGGGCCGCAGG - Intergenic
1055139839 9:72863901-72863923 TGTTGAGAAGAAGGAGCCGCAGG + Intergenic
1055403348 9:75947963-75947985 TCTTGAGGAGCTGGGACCACAGG + Intronic
1056914087 9:90729828-90729850 TGCTGTGGAGCAGGGGACGGTGG - Intergenic
1057952946 9:99384557-99384579 TGTTCAGGAGCAGCGGTCACTGG + Intergenic
1058431411 9:104923916-104923938 TCTTAAGGAGCTGGGGCCACAGG - Intronic
1060031440 9:120218121-120218143 TTTTGAGGAGGAGGGGCTGCTGG - Intergenic
1061139969 9:128760001-128760023 TGTTGAGTAGCTGGGACCACAGG + Intronic
1061991626 9:134162469-134162491 TGTGGTGGAGCAGGGGGTGCAGG + Intergenic
1062033473 9:134372386-134372408 TGGTGTGGAGTGGGGGCCGCAGG + Intronic
1062304141 9:135893044-135893066 TCTTGAGGAGCAGGGACTACAGG - Intronic
1062543159 9:137050430-137050452 TGTTGAAGTTCTGGGGCCGCTGG + Exonic
1062560389 9:137139088-137139110 TGTTGGGAAGCGGGGGCGGCGGG + Intronic
1203769482 EBV:41560-41582 TGTTGAAGGGCAGGGGCTGTTGG + Intergenic
1187825845 X:23333461-23333483 TGTTGAGCCGCAGGGGGCGCGGG - Intergenic
1196819917 X:119693753-119693775 TGTGGAGCGGCAGGTGCCGCAGG - Intergenic