ID: 1161979753

View in Genome Browser
Species Human (GRCh38)
Location 19:7624271-7624293
Sequence TCTGGGGGCCCCGGCTGGTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 372
Summary {0: 1, 1: 0, 2: 0, 3: 20, 4: 351}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161979753_1161979766 11 Left 1161979753 19:7624271-7624293 CCCCACCAGCCGGGGCCCCCAGA 0: 1
1: 0
2: 0
3: 20
4: 351
Right 1161979766 19:7624305-7624327 CTCCTCGCGCCCCAGCTCCGAGG 0: 1
1: 0
2: 2
3: 21
4: 247
1161979753_1161979768 14 Left 1161979753 19:7624271-7624293 CCCCACCAGCCGGGGCCCCCAGA 0: 1
1: 0
2: 0
3: 20
4: 351
Right 1161979768 19:7624308-7624330 CTCGCGCCCCAGCTCCGAGGCGG 0: 1
1: 0
2: 0
3: 9
4: 113

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161979753 Original CRISPR TCTGGGGGCCCCGGCTGGTG GGG (reversed) Intronic
900492843 1:2961256-2961278 TCTGGGAGACCCAGCTGGTGGGG - Intergenic
900880507 1:5377971-5377993 TCAGGGGGCTCTGGCTGGTGGGG + Intergenic
900953949 1:5875459-5875481 TGTTGGGGACCTGGCTGGTGAGG - Intronic
901271371 1:7954361-7954383 TCTGGTGGCCCACGCTGGGGGGG + Intronic
901633289 1:10658270-10658292 ACTGGGGGCACAGGCTGCTGAGG + Intronic
901664643 1:10819459-10819481 TCTGGGGACCCAGCCAGGTGTGG + Intergenic
901810918 1:11766403-11766425 GCTGGAGGTCCAGGCTGGTGGGG + Exonic
902278172 1:15354542-15354564 TCTGGGGGACACGGCTGCTTGGG - Intronic
902372962 1:16016984-16017006 TCTGGGGTCCCAGGATGGTAAGG + Intronic
902639183 1:17755810-17755832 TGTGGGGGCACCGCCTGGAGGGG + Intronic
903141459 1:21341714-21341736 TCTGGGAGCCCCATCTGGAGTGG + Intronic
903451418 1:23456087-23456109 CCTGGGTGCCCCGCCTGGTCAGG - Intronic
903745564 1:25584492-25584514 CCTGGGGACCTCTGCTGGTGTGG - Intergenic
903945413 1:26959743-26959765 GCTGGGGGCAGAGGCTGGTGCGG - Intronic
904385868 1:30141732-30141754 TCAGGTGGCCCTGGCTGATGGGG - Intergenic
904442126 1:30538921-30538943 TCTGGTTCCCACGGCTGGTGAGG - Intergenic
904921990 1:34015131-34015153 TCTGGGGGCTCCAGCTAGTATGG - Intronic
911354482 1:96799158-96799180 TCTGGGTGACCCAGCTGATGAGG + Intronic
912965300 1:114231613-114231635 TCCTGGGCACCCGGCTGGTGAGG + Intergenic
913392764 1:118332925-118332947 TCTGGGGTCACATGCTGGTGCGG + Intergenic
915021967 1:152787597-152787619 TCAGGGGGCTCCAGCTGCTGTGG + Exonic
915022931 1:152798080-152798102 TCGGGGGGCTCCAGCTGCTGCGG + Exonic
915023568 1:152805159-152805181 TCGGGGGGCTCCAGCTGCTGTGG - Exonic
915024297 1:152812744-152812766 TCCGGGGGCTCCAGCTGCTGTGG + Exonic
916108624 1:161447869-161447891 TCTGGCGGCCCCGGGCGGCGAGG - Intergenic
916110212 1:161455250-161455272 TCTGGCGGCCCCGGGCGGCGAGG - Intergenic
916111797 1:161462660-161462682 TCTGGCGGCCCCGGGCGGCGAGG - Intergenic
916113384 1:161470041-161470063 TCTGGCGGCCCCGGGCGGCGAGG - Intergenic
917055641 1:170978460-170978482 GCCAGGGGCCCTGGCTGGTGAGG + Intronic
918083341 1:181224127-181224149 GTTGGGGGCACCTGCTGGTGAGG + Intergenic
918175072 1:182036270-182036292 TCAGGGGGACCAGGATGGTGTGG + Intergenic
918348989 1:183635166-183635188 GAAGGCGGCCCCGGCTGGTGGGG - Intronic
920004014 1:202819538-202819560 TCTGGGGGTGCAGCCTGGTGCGG - Intergenic
922440552 1:225652713-225652735 TCTGCGTCTCCCGGCTGGTGGGG - Exonic
922934354 1:229411829-229411851 TTTGGGAGCTTCGGCTGGTGTGG - Intergenic
1070172109 10:73940770-73940792 TCTGGCGGCCCCTGCTGGGCTGG + Intergenic
1070962538 10:80509244-80509266 TGTGGGGGTGCAGGCTGGTGGGG + Intronic
1072537044 10:96371708-96371730 TCACGGGGCCCAGGCAGGTGGGG - Intronic
1072552345 10:96488435-96488457 TGTGGGAGCCCGGGCTGGCGTGG - Intronic
1073125947 10:101149410-101149432 TCGGGAGGCCCAGGCTAGTGAGG + Intergenic
1074581663 10:114724867-114724889 TCTGGTGGCTCTGCCTGGTGTGG - Intergenic
1076675283 10:132144369-132144391 TCTGGAAGCCCCGGGTGGTGTGG - Intronic
1076947943 10:133664834-133664856 TCCGGGGGCGCGGGCTGGGGAGG - Intergenic
1076948933 10:133668144-133668166 TCCGGGGGCGCGGGCTGGGGAGG - Exonic
1076949917 10:133671443-133671465 TCCGGGGGCGCGGGCTGGGGAGG - Intronic
1076950901 10:133674742-133674764 TCCGGGGGCGCGGGCTGGGGAGG - Intergenic
1076951891 10:133678052-133678074 TCCGGGGGCGCGGGCTGGGGAGG - Intergenic
1076952880 10:133681362-133681384 TCCGGGGGCGCGGGCTGGGGAGG - Intergenic
1076953864 10:133684661-133684683 TCCGGGGGCGCGGGCTGGGGAGG - Intergenic
1076954848 10:133741013-133741035 TCCGGGGGCGCGGGCTGGGGAGG - Intergenic
1076955837 10:133744323-133744345 TCCGGGGGCGCGGGCTGGGGAGG - Intergenic
1076956827 10:133747633-133747655 TCCGGGGGCGCGGGCTGGGGAGG - Intergenic
1076957814 10:133750942-133750964 TCCGGGGGCGCGGGCTGGGGAGG - Intergenic
1076958799 10:133754241-133754263 TCCGGGGGCGCGGGCTGGGGAGG - Intergenic
1076959788 10:133757551-133757573 TCCGGGGGCGCGGGCTGGGGAGG - Intergenic
1076960772 10:133760850-133760872 TCCGGGGGCGCGGGCTGGGGAGG - Intergenic
1077311618 11:1891337-1891359 CCTGGGGGCTGCCGCTGGTGGGG + Intronic
1077494372 11:2879370-2879392 TCTCACGGCCCCGGCTGGTTCGG - Intergenic
1078090772 11:8263187-8263209 GCTGGGGGCCGGGGCTGGGGCGG - Intronic
1079986934 11:27209546-27209568 TCTGGAGACCCCAGCTGGTTAGG + Intergenic
1080386043 11:31811751-31811773 TCTTGGGGCCCCGGCTGGGATGG - Intronic
1081154133 11:39667923-39667945 TCTCAGGACCCCTGCTGGTGTGG + Intergenic
1081668094 11:44928181-44928203 TCTGAGGGCCTGGGGTGGTGGGG - Intronic
1082263162 11:50093044-50093066 ACTGGGGGCCAAGGCAGGTGGGG + Intergenic
1083603465 11:63962664-63962686 TCTGGGGGCCGCCTCTGGGGTGG + Intergenic
1084164758 11:67370388-67370410 GCTGGGGGCCAGGACTGGTGGGG - Intronic
1084463123 11:69307331-69307353 TCTGGGCACCCCAGCAGGTGAGG + Intronic
1084574132 11:69977716-69977738 TCTGGGGGACTCCCCTGGTGAGG - Intergenic
1084891002 11:72237221-72237243 TCCGGGGGCAGCAGCTGGTGCGG - Exonic
1084980645 11:72826854-72826876 CCTGGGGCTCCTGGCTGGTGGGG - Intronic
1085353492 11:75815601-75815623 TCTGGGTGTCCCGGCTCGCGGGG - Intronic
1086268343 11:85028727-85028749 TGTGGGGGCCAGGGCTGGAGAGG + Intronic
1089200804 11:116723757-116723779 TCTAAGGGGCCCGGCTGCTGTGG - Intergenic
1089712380 11:120325215-120325237 TCTGGGGGCACCTGCTGGCTGGG - Intronic
1090670403 11:128941625-128941647 TCTGCTTGCCCCGGCTGCTGGGG + Intronic
1091367793 11:135036935-135036957 TCTGGGGCCACGGGCTGGGGTGG + Intergenic
1091372694 11:135073991-135074013 GCTGGGGGCCCAGGCTGGGAGGG - Intergenic
1092660474 12:10733162-10733184 TCTGGCGGCCCCGTCTAGTCTGG + Intergenic
1093643551 12:21555852-21555874 TCTGGGTCCCCTTGCTGGTGGGG - Intronic
1102035399 12:109768276-109768298 TTTGGCGGGCCCAGCTGGTGCGG - Exonic
1102455704 12:113069654-113069676 GCTGGGGGCACCGGCTGGGCTGG - Intronic
1102520634 12:113475851-113475873 TCTGGGGGCCCAGGTGGCTGGGG + Intergenic
1103802733 12:123549848-123549870 ACTTGGGGCCCTGGCTAGTGTGG - Intergenic
1103930493 12:124448279-124448301 TCTGGGGCCCCTGTCTGGGGTGG - Intronic
1104668028 12:130661231-130661253 TCTGGGTGCCCCTGCTGCTTAGG + Intronic
1104733506 12:131122073-131122095 TCTGAGGGCCCTGGCTGGTTGGG + Intronic
1104845322 12:131844041-131844063 TCTGGGGGCTCCGGCAGCAGGGG - Exonic
1104961109 12:132489248-132489270 TCGGAGGGGCCCGCCTGGTGGGG - Intergenic
1105068129 12:133217470-133217492 TCTGGGGGAGCCGGCATGTGGGG + Intergenic
1105963676 13:25366122-25366144 TCTTGTGGCGCCGGATGGTGAGG + Intergenic
1110764732 13:79269795-79269817 TCTGGGGGGCAGGGGTGGTGGGG - Intergenic
1111819648 13:93196867-93196889 TCTAGGGGCCACATCTGGTGAGG + Intergenic
1113887145 13:113666991-113667013 TCTGGGGCCCCTGGCTGGAGAGG - Intergenic
1113909261 13:113834490-113834512 TCCGGGGGCCCTCGCCGGTGGGG - Intronic
1113936041 13:113995898-113995920 GATGGGGGACCCGGCTGATGGGG + Intronic
1113936066 13:113995947-113995969 AATGGGGGGCCCGGCTGATGGGG + Intronic
1113936073 13:113995963-113995985 GATGGGGGACCCGGCTGATGGGG + Intronic
1113936094 13:113996013-113996035 GATGGGGGACCCGGCTGATGGGG + Intronic
1113936120 13:113996063-113996085 GATGGGGGGCCCGGCTGATGGGG + Intronic
1113936128 13:113996079-113996101 GATGGGGGGCCCGGCTGATGGGG + Intronic
1118757988 14:68859265-68859287 TCTGGCGGCAGCGGCTTGTGGGG - Intergenic
1118809410 14:69262028-69262050 TCTGGAGGCCACTGCTGGTTTGG - Intronic
1119197988 14:72731778-72731800 TGTGGGGTCCCCAGCAGGTGTGG + Intronic
1119715369 14:76855229-76855251 TCTGGGAGTCCCAGCTGGGGTGG + Intronic
1119777847 14:77259363-77259385 TCTGGGGCCCCCGGTCGGGGGGG + Exonic
1120195403 14:81476991-81477013 TCTGGTGGCCCCTCCTGCTGGGG + Exonic
1121013550 14:90535235-90535257 GCTGGGGGCCTGGGCAGGTGTGG - Exonic
1121595419 14:95158014-95158036 TCTGGGGATCCCGGTTGGGGTGG - Intergenic
1122416490 14:101552147-101552169 CCTGGCGGACCCGGCTGGGGTGG - Intergenic
1122971403 14:105153716-105153738 TCTGGGGGGCCTGGTGGGTGGGG - Intronic
1123066223 14:105620827-105620849 TCTGGGGGCACCAGGTGGAGAGG - Intergenic
1123070364 14:105639879-105639901 TCTGGGGGCACCAGGTGGAGAGG - Intergenic
1123074956 14:105663539-105663561 TCTGGGGGCACCAGGTGGAGAGG - Intergenic
1123089600 14:105736667-105736689 TCTGGGGGCACCAGGTGGAGAGG - Intergenic
1123095393 14:105764827-105764849 TCTGGGGGCACCAGGTGGAGAGG - Intergenic
1202853752 14_GL000225v1_random:37353-37375 TCCGGGGGCGCGGGCTGGCGAGG - Intergenic
1202854858 14_GL000225v1_random:43795-43817 TCCGGGGGCGTCGGCTGGCGAGG - Intergenic
1202868122 14_GL000225v1_random:136059-136081 TCCGGGGGCATGGGCTGGTGAGG + Intergenic
1125578384 15:40769742-40769764 GCTGGGGGCCCAGGGTGGTGGGG + Intronic
1125592314 15:40862377-40862399 TCTGGGAGCCACTGCAGGTGGGG - Intergenic
1126174515 15:45723033-45723055 TCTGGTGGCCACATCTGGTGAGG - Intergenic
1127070345 15:55282687-55282709 TCTGGGGTCCCCTGCTCATGTGG + Intronic
1127582725 15:60352331-60352353 CCTTGGGGCCCTGGCTGGGGCGG - Intronic
1128053830 15:64685030-64685052 GCTGGAGGCCCGGGCTGGAGGGG + Exonic
1128391696 15:67186893-67186915 TCTGGGGGCACTGCCTGCTGTGG + Intronic
1128731975 15:70027296-70027318 TCTGGGGACACCGGCTGGGCAGG - Intergenic
1129187889 15:73921634-73921656 AGTGGGTGCCCAGGCTGGTGGGG - Intergenic
1129708478 15:77808103-77808125 GCTGGGGGCCATGGGTGGTGGGG - Intronic
1130986809 15:88849674-88849696 TCTGGGAGGCCCGTCTGGTTAGG - Exonic
1132146947 15:99434836-99434858 TCGGGAGCCCCGGGCTGGTGGGG - Intergenic
1132550177 16:550950-550972 TGTGAGGGCCCCGGTCGGTGAGG + Intronic
1132657579 16:1047831-1047853 CCTGGGCGCCCAGGCTTGTGTGG + Intergenic
1132846690 16:2004013-2004035 GGTGAGGGCCCCGGCCGGTGGGG - Intronic
1132976211 16:2712380-2712402 TTGGGGGACCCCGGCGGGTGAGG - Intergenic
1133062287 16:3182911-3182933 CCGGGGGGCCCCGGATTGTGGGG - Intergenic
1133769252 16:8858311-8858333 TCTGGGTGGCCTGGCTGGGGTGG - Intronic
1134880764 16:17743735-17743757 TCAGGGAGGCCCGGCTGGTGGGG - Intergenic
1136927752 16:34389566-34389588 TCTGGAGTCCTCGGCGGGTGGGG + Intergenic
1136976822 16:35022240-35022262 TCTGGAGTCCTCGGCGGGTGGGG - Exonic
1137555932 16:49470358-49470380 CCTGGGGGCCCGGGGTTGTGTGG + Intergenic
1137585411 16:49661383-49661405 TTTGGGGGTCCCCCCTGGTGGGG - Intronic
1137610226 16:49813008-49813030 TGTGGGTGCCCCTGGTGGTGTGG - Intronic
1138447964 16:57076670-57076692 TCTGGGGGTCATGGCAGGTGGGG - Intronic
1138652112 16:58466516-58466538 TCTGGTGACCCCATCTGGTGGGG - Intronic
1138659842 16:58510449-58510471 TCTGGGGGCCACTGCTGGGTGGG + Intronic
1139594618 16:67950488-67950510 TCTGGTGGCCCCTGCAGGTATGG - Exonic
1140017831 16:71205519-71205541 TCTGGGGCCCAAGGCTTGTGGGG - Intronic
1141149099 16:81551971-81551993 CAGGGGGGCCCTGGCTGGTGGGG + Intronic
1141317368 16:82975180-82975202 CCTTGGGGCCCTGGCTGCTGTGG + Intronic
1141655755 16:85415562-85415584 GCTCGGGGCCCTGGCTGGTAGGG - Intergenic
1142034685 16:87855778-87855800 CCTGTGGGCCCCGGCTGGGTGGG + Intronic
1142253674 16:89003704-89003726 GCTGGGTGCCCCTGATGGTGGGG - Intergenic
1142264083 16:89055586-89055608 ACTGGAGGCCCTGGCTGGGGAGG - Intergenic
1142847816 17:2690651-2690673 TCCTGGGGCCCCCGCTGGCGCGG + Exonic
1143014154 17:3882854-3882876 TTTGGGGGCCCAGCCTGGTCAGG - Intronic
1143583258 17:7838504-7838526 GCTTGGGGCCAGGGCTGGTGAGG + Intergenic
1143604426 17:7973748-7973770 TCTGGTTGCCCAGGCTGGAGTGG - Intergenic
1146774493 17:35600867-35600889 TCTGGGCTCCCCGTCTGGTTAGG - Intronic
1147123711 17:38351959-38351981 TCCGGGGGCCGCGGCGGGCGGGG + Intergenic
1147734280 17:42625098-42625120 CCTTGGGGCCCAGGCTGATGGGG - Intergenic
1148109600 17:45137094-45137116 TCTGGGGGCCTCGGCATGTCAGG - Exonic
1148695589 17:49556318-49556340 TCTCAGGGCCCCGGCCGGTGAGG - Intergenic
1148743871 17:49907809-49907831 TCTCTGGGCCCAGGCTAGTGGGG + Intergenic
1149550133 17:57533745-57533767 TCAGGGGTCCCCAGCTGGGGTGG + Intronic
1150347077 17:64412414-64412436 TCTGGGGGCTCAGTCTGGAGAGG - Intronic
1151964337 17:77423531-77423553 TGTGGGGGCCCCTGTTGGGGTGG + Intronic
1152286480 17:79415924-79415946 TCTGGGGGCGTCTGCAGGTGAGG - Intronic
1152299083 17:79485014-79485036 TCTGGGAGCCCTGTCTGGGGAGG - Intronic
1152414058 17:80147498-80147520 TCTGGGGACCCCGCCCGGAGCGG - Intergenic
1152561381 17:81080455-81080477 GCTGGGGGCTCGGGCTGGCGGGG + Intronic
1152573226 17:81129470-81129492 TCTGCGGTCCCCAGCGGGTGGGG + Intronic
1152744662 17:82033196-82033218 TCTGAGGGCTCTGGCTGCTGGGG + Intronic
1152779367 17:82219535-82219557 TCTGGAGGCCCCAGCTGGCAGGG + Intergenic
1153641116 18:7157997-7158019 TCTGGAGGCGTGGGCTGGTGGGG + Intergenic
1153767176 18:8385663-8385685 CTTGGGGGCCCCGGCTGGAAGGG + Intronic
1157582420 18:48781301-48781323 TCTGGGGGCGGCGGCTGGGAGGG + Intronic
1157827468 18:50825037-50825059 TCTTGTGGCCCAGGCTGGAGTGG - Intronic
1160985616 19:1837272-1837294 TCTGGGGGTCCCTGCTCCTGGGG + Intronic
1161201154 19:3015588-3015610 TCTGAGGGGCCAGGCTGGTCTGG + Intronic
1161302811 19:3551230-3551252 CCTGGGAGCCCTGGCTGGTGCGG - Intronic
1161554503 19:4932998-4933020 TCCGGGGGCCCCGGGAGGGGAGG - Intronic
1161698511 19:5783129-5783151 GCAGGGGGCCCCGGGTGGGGCGG + Exonic
1161707974 19:5831150-5831172 ACTGGGGACCTCGGCTGTTGGGG - Exonic
1161815215 19:6495661-6495683 GCTGGCTGCCCCGGCTGGTCAGG + Exonic
1161979753 19:7624271-7624293 TCTGGGGGCCCCGGCTGGTGGGG - Intronic
1162043015 19:7981792-7981814 TCTGTGGGGCCTGGGTGGTGAGG + Intronic
1162959615 19:14118082-14118104 TCTGCGGGCCCGGGCCGGCGGGG + Intronic
1163863627 19:19755240-19755262 TCAGGGGGTCCTGGCTAGTGGGG - Intergenic
1164137743 19:22428655-22428677 GCTGGGGGCCCCGGCAGGGCGGG + Intronic
1165065481 19:33225848-33225870 ACTGGGGGCCCCGGGCGGCGGGG + Exonic
1165520642 19:36311445-36311467 TTTGGTGGCCCCGGCGGGTTAGG - Intergenic
1165623428 19:37267139-37267161 TTTGGTGGCCCCGGCTGGTTAGG + Intergenic
1166048942 19:40246803-40246825 TCTTGGAGCCCCAGCTGGGGTGG - Intronic
1166682315 19:44776702-44776724 TCTGGGTGCCCCTAATGGTGTGG - Intergenic
1167467578 19:49658340-49658362 TCTGGGGGCCCTGGCTCCTTGGG - Exonic
1168423534 19:56220686-56220708 TCTTGTTGCCCAGGCTGGTGTGG - Exonic
925853797 2:8110138-8110160 TCTGGGGGCTCAGGAGGGTGAGG + Intergenic
926718639 2:15942741-15942763 CCCCGGGGCCCCGGCTGGGGCGG - Exonic
929571291 2:43024661-43024683 TCTGGAGACCTCTGCTGGTGAGG - Intergenic
933772603 2:85753823-85753845 TCGGGCGGCCCGGGCTGGGGAGG + Intronic
934031822 2:88055456-88055478 TCCGGGGGCGGCGGCCGGTGAGG + Intronic
934572978 2:95383819-95383841 TCCGAGGTCCCCAGCTGGTGAGG - Intronic
934638813 2:96013821-96013843 TCTGGGCACCCCACCTGGTGGGG + Intergenic
934978346 2:98821931-98821953 TCGGGGGGCGCGGGCTGGTGCGG + Exonic
936073749 2:109388466-109388488 CCTGGGGGGCCTGGCTGGGGAGG - Intronic
937354232 2:121187965-121187987 TCTGGGGGCCCAGGCAGGGCGGG + Intergenic
937371831 2:121303734-121303756 CCTCCGGGCCACGGCTGGTGTGG - Intergenic
938416141 2:131105258-131105280 GCGGCGGGCCCCGGCCGGTGGGG - Exonic
946374144 2:219298010-219298032 TCTGGTGGCCCTGGCAGGTGTGG - Exonic
946415943 2:219539729-219539751 TCTGGGGGCCCAGGCCCTTGTGG + Exonic
946596334 2:221309781-221309803 TCTGTGGGACCCTGCAGGTGTGG + Intergenic
948536396 2:238650614-238650636 TCTGGGGGCCTGGGGTGCTGAGG - Intergenic
948868653 2:240787510-240787532 TCAGGGGTCCCTGGCTGGTGTGG + Intronic
1168891927 20:1300452-1300474 TCTGGTGGCCAGGGATGGTGAGG + Intronic
1169450035 20:5702962-5702984 TCTGGTTGCCCAGGCTGGAGTGG + Intergenic
1170924988 20:20714115-20714137 TCTGGGGACTCAGGCTGGTAGGG - Intergenic
1172432790 20:34906416-34906438 GCTGGGGCCCCTGGCTGGTTGGG - Intronic
1172916518 20:38447532-38447554 AATGGGGGCGCTGGCTGGTGCGG - Intergenic
1174462329 20:50691566-50691588 GGTGGGGGCCCCGCCTGCTGGGG - Intergenic
1174475917 20:50795400-50795422 GCTGGGGGACCCGGGTGGGGAGG - Intronic
1176042287 20:63072127-63072149 CCTGGGGGCGCGGGCAGGTGTGG - Intergenic
1176230939 20:64032615-64032637 TCTGTGGGCTGAGGCTGGTGGGG + Intronic
1176299895 21:5094646-5094668 TCTGGGGGACAGGGCAGGTGGGG + Intergenic
1176429874 21:6569002-6569024 CCTGGTGTCCCCAGCTGGTGAGG + Intergenic
1178163607 21:29946837-29946859 TATTGTGGCCCAGGCTGGTGGGG - Intergenic
1179705268 21:43176464-43176486 CCTGGTGTCCCCAGCTGGTGAGG + Intergenic
1179818320 21:43922161-43922183 TGTGGAGGCCCAGGCTTGTGGGG + Intronic
1179857127 21:44167265-44167287 TCTGGGGGACAGGGCAGGTGGGG - Intergenic
1180960413 22:19759851-19759873 GCTGGGCCCCCAGGCTGGTGAGG - Intronic
1181005251 22:20010375-20010397 TCTGGTGGGCCTGGCGGGTGGGG - Intronic
1181058915 22:20272738-20272760 TCTGGGGAGGCCGGCTGGTGGGG + Intronic
1181985719 22:26798864-26798886 GCTGGGAGCCCAGGCTGGGGAGG - Intergenic
1182711370 22:32325346-32325368 TCTTGGGGCCCTGGCCGGGGTGG + Intergenic
1183264751 22:36818285-36818307 TGTGGTGGCCCTGGGTGGTGGGG + Intronic
1183417129 22:37688955-37688977 TCTCGGGGGCCCGGCTGCTCGGG + Exonic
1183571396 22:38656204-38656226 TTTGGGGGCACCGGCTGTCGGGG - Exonic
1184330103 22:43821804-43821826 TCTGAGGGCCCTGGCTGGGGTGG + Intergenic
1184523088 22:45007400-45007422 TCCGGCGGCCCGGGCTGGGGTGG + Intronic
1184607903 22:45584830-45584852 TCTCGCGGCCTGGGCTGGTGAGG + Intronic
1184715607 22:46280170-46280192 TCTGCAGCCCCAGGCTGGTGAGG + Intronic
950040086 3:9914752-9914774 ACTGTGGGCGCCGGCAGGTGAGG - Exonic
950537144 3:13585203-13585225 CCTGATGGCCACGGCTGGTGGGG - Intronic
953405381 3:42657273-42657295 TCTGGAAGCCCCAGATGGTGTGG + Intronic
953420062 3:42747360-42747382 TCTGGGGTCTCCAGCTGGTTGGG + Exonic
953635940 3:44664283-44664305 TCTGCGTGCCCCAGGTGGTGGGG - Intergenic
953948276 3:47167144-47167166 TCTTGTTGCCCAGGCTGGTGTGG - Intergenic
954110998 3:48432995-48433017 CCTGGGGGCCCTGATTGGTGTGG - Exonic
954442691 3:50530457-50530479 GCGGGGGGCGCCGGCTGCTGCGG + Intergenic
955275637 3:57544386-57544408 TGTGGCGGCCCCAGCTGGAGGGG + Intergenic
955397712 3:58569022-58569044 TGTGGTGGGCCCGTCTGGTGAGG - Intronic
956741999 3:72282393-72282415 TCCTGGGGCCACGTCTGGTGAGG - Intergenic
960937799 3:122913806-122913828 TCTGGGGGGCCCGGTTAGTCTGG + Intronic
961090531 3:124107504-124107526 TCTAGGGGGCCAGGTTGGTGGGG - Intronic
961385284 3:126519849-126519871 CCAGGTGGCCCTGGCTGGTGAGG - Intergenic
961505714 3:127369498-127369520 GCAGTGGGCCTCGGCTGGTGGGG - Intergenic
965560443 3:170057249-170057271 TCTGGTTGCCCCTGCTGGAGAGG - Intronic
966871080 3:184290954-184290976 TCTGTGGACCAGGGCTGGTGGGG + Intronic
968428322 4:537559-537581 TGTGGGGTCCCCGGCCTGTGGGG + Intronic
968683468 4:1938565-1938587 TCTGGGTGCCCAGGCTGGGCTGG + Intronic
968704965 4:2073453-2073475 CCTGGTGGCTCTGGCTGGTGGGG - Intronic
968803042 4:2755792-2755814 TGAGGGGGCCCCGGCTCCTGAGG - Intronic
968948300 4:3677044-3677066 ACTGGGGGCCGGGGCTGATGCGG + Intergenic
969053748 4:4389058-4389080 GCTGGGGGCCCAGGCAGGAGGGG - Intronic
969106467 4:4810570-4810592 TCTCGGGGCCCTGGCTGGCAAGG + Intergenic
969694191 4:8725552-8725574 TGGAGGGGCCCCGGCTGGAGGGG + Intergenic
970212074 4:13720321-13720343 TCTGGGGGCCACGGGTAGGGGGG - Intergenic
977002142 4:91518305-91518327 TCTGTGGGCCCAAGCTGGGGAGG + Intronic
979550792 4:121988817-121988839 TCTGGAGGCCCAGGCAGGTGAGG - Intergenic
979674785 4:123398689-123398711 CCTGGGGGCCGCGGCTTCTGGGG + Intronic
980075217 4:128287532-128287554 TCTGGGGGCCGGGGCCGGGGCGG - Exonic
985445987 4:190021650-190021672 TCCGGGGGCGCGGGCTGGGGAGG + Intergenic
985452387 4:190068928-190068950 TCCGGGGGCGCGGGCTGGGGAGG - Intergenic
985453372 4:190072225-190072247 TCCGGGGGCGCGGGCTGGGGAGG - Exonic
985454362 4:190075518-190075540 TCCGGGGGCGCGGGCTGGGGAGG - Exonic
985455350 4:190078811-190078833 TCCGGGGGCGCGGGCTGGGGAGG - Exonic
985456337 4:190082111-190082133 TCCGGGGGCGCGGGCTGGGGAGG - Exonic
985457322 4:190085405-190085427 TCCGGGGGCGCGGGCTGGGGAGG - Intergenic
985458309 4:190088698-190088720 TCCGGGGGCGCGGGCTGGGGAGG - Exonic
985459298 4:190091998-190092020 TCCGGGGGCGCGGGCTGGGGAGG - Exonic
985463550 4:190174767-190174789 TCCGGGGGCGCGGGCTGGGGAGG - Exonic
985680350 5:1252799-1252821 GATGGGGGCCCCAGCTGGGGTGG - Intergenic
986299629 5:6467763-6467785 TCTGGGGGGCGCGGGTGGAGAGG - Intronic
988270232 5:29004518-29004540 TCTGGGGGGCAGGGGTGGTGTGG - Intergenic
990299104 5:54432838-54432860 TGTGGGCTGCCCGGCTGGTGAGG - Intergenic
994644515 5:102451555-102451577 TCTGGAGGCCCTGGATGGAGTGG + Intronic
996443020 5:123512660-123512682 GCTGGGGTCCCGGGCGGGTGGGG + Intronic
997569822 5:134917736-134917758 TCTGGGTGCCCAGGCTGGGTTGG + Intronic
1000257688 5:159556303-159556325 TCTGGTGGCCTCTGCCGGTGAGG + Intergenic
1001066060 5:168535927-168535949 TCTGGGGGACCAGCCTGGGGAGG + Intergenic
1001163017 5:169338142-169338164 ACTGGGGGCCACAACTGGTGAGG + Intergenic
1001400975 5:171446306-171446328 TGCGGTGGCCCTGGCTGGTGAGG + Intronic
1002691635 5:181054089-181054111 TCTGCGGGCCCAGGCTGGGCTGG - Intronic
1002798825 6:501980-502002 TCTGGGGACACCGGGGGGTGTGG - Intronic
1003026370 6:2558925-2558947 TCCAGGGGGCCAGGCTGGTGGGG + Intergenic
1003097494 6:3154363-3154385 GCTGGCTGCCCCGGCTGGTCAGG + Exonic
1003107034 6:3225251-3225273 GCTGGCTGCCCCGGCTGGTCAGG + Exonic
1006459141 6:34148204-34148226 TCTGGAGGCCCGGGGTGGTCAGG - Intronic
1006807856 6:36800107-36800129 GCTGGTGGGGCCGGCTGGTGGGG + Intronic
1011258675 6:85450037-85450059 GCTCGGTGCCCCGGCTGGAGGGG - Intronic
1011707820 6:90020531-90020553 TCTAGGGGCCGCATCTGGTGAGG - Intronic
1012530201 6:100226435-100226457 TCTGGGGGCTCAGGCTGGAGAGG - Intergenic
1013422474 6:109978972-109978994 TCTGGGGTCCCAGGGTGGGGTGG + Intronic
1016289008 6:142507113-142507135 GCTGGGGGGCCAGCCTGGTGAGG + Intergenic
1018364157 6:163100585-163100607 GCTGTGGGCCCAGGCAGGTGTGG - Intronic
1018860310 6:167706566-167706588 TCTGCGGGGCCCAGCTGGCGTGG - Intergenic
1019477014 7:1249137-1249159 GCTGGGGGCACCTGCTGATGAGG + Intergenic
1019570436 7:1708992-1709014 GCTGGTGGCTCCGGCAGGTGGGG + Intronic
1019664706 7:2246013-2246035 GCTGGGGGCCGCAGCTGGGGAGG + Intronic
1019989983 7:4683648-4683670 ACTTGAGGCCCTGGCTGGTGGGG - Intronic
1020348043 7:7186036-7186058 TCAGGGGGCCACATCTGGTGAGG + Intronic
1021081448 7:16370269-16370291 TCTGGGTGCCCAGCCTTGTGGGG + Intronic
1023875416 7:44283890-44283912 TGGTGGGGCCCAGGCTGGTGGGG - Intronic
1024382074 7:48708571-48708593 TTTAGAGGCCCCGGCTGGAGAGG + Intergenic
1024939526 7:54747345-54747367 TCTGGAGGGCCTGGCTGGGGTGG - Intergenic
1024965686 7:55020212-55020234 GCTGGGGTCCCCGGGAGGTGGGG - Intronic
1028622209 7:92836705-92836727 GCTGGGGGCCCCAGCCGGGGAGG + Intergenic
1029491923 7:100875346-100875368 CCTGGGGGGCCCCGCTGGGGCGG + Intronic
1030266628 7:107628653-107628675 TCTGGTAGCTCTGGCTGGTGTGG + Intronic
1032016062 7:128381075-128381097 GCTGGGGGCAGGGGCTGGTGGGG + Intergenic
1034426518 7:151016921-151016943 GCTGGGGGCGGGGGCTGGTGAGG + Intronic
1034490026 7:151388153-151388175 TCTGGGAGCCCGAGGTGGTGGGG - Intronic
1034500687 7:151448653-151448675 CCAGGGGGCCCGGGCTGGCGGGG - Intergenic
1034535923 7:151725742-151725764 CCTGGGGGCCCCGGGTGCTGAGG - Intronic
1036295062 8:7528721-7528743 CCCGGAGGCCCGGGCTGGTGAGG - Intergenic
1036327501 8:7792270-7792292 CCCGGAGGCCCGGGCTGGTGAGG + Intergenic
1036386059 8:8282932-8282954 TCTGGGGGCCCAGTCTTGGGAGG + Intergenic
1037599766 8:20384260-20384282 TCTGCGTGCCCATGCTGGTGTGG + Intergenic
1038226529 8:25663291-25663313 TGTGGGGGCCCTGGCTGACGAGG + Intergenic
1038286893 8:26213264-26213286 GCTGGAGGACCCGGGTGGTGAGG - Intergenic
1038436403 8:27539761-27539783 TCTGGAGCACCCGCCTGGTGGGG + Intronic
1039535707 8:38310540-38310562 TCTGGTTGCCCAGGCTGGAGTGG + Intronic
1040683900 8:49847197-49847219 TCTGGGGGCTCTGGCTCATGAGG + Intergenic
1042916161 8:73878282-73878304 TCTGGGGGGCCCGGCGTGGGAGG + Intronic
1048269449 8:133016999-133017021 CCTGGGTGCCCCAGCTTGTGAGG - Intronic
1049197884 8:141325479-141325501 TGTCGGGGCCACGGCAGGTGGGG - Intergenic
1049479598 8:142815556-142815578 GCTGGGGGCTCAGGCTGATGGGG + Intergenic
1049542396 8:143214546-143214568 GCTGGGGGCCCTGGCTAGGGAGG - Intergenic
1049636528 8:143692412-143692434 TGTGGAGCCCCCGGCTGGGGAGG + Intronic
1049636544 8:143692452-143692474 TGTGGAGCCCCCGGCTGGGGAGG + Intronic
1049636560 8:143692492-143692514 TGTGGAGCCCCCGGCTGGGGAGG + Intronic
1049636576 8:143692532-143692554 TGTGGAGCCCCCGGCTGGGGAGG + Intronic
1049636591 8:143692572-143692594 TGTGGAGCCCCCGGCTGGGGAGG + Intronic
1049636607 8:143692612-143692634 TGTGGAGCCCCCGGCTGGGGAGG + Intronic
1049636623 8:143692652-143692674 TGTGGAGCCCCCGGCTGGGGAGG + Intronic
1049636638 8:143692692-143692714 TGTGGAGCCCCCGGCTGGGGAGG + Intronic
1049636654 8:143692732-143692754 TGTGGAGCCCCCGGCTGGGGAGG + Intronic
1049636669 8:143692772-143692794 TGTGGAGCCCCCGGCTGGGGAGG + Intronic
1049636684 8:143692812-143692834 TGTGGAGCCCCCGGCTGGGGAGG + Intronic
1049636699 8:143692852-143692874 TGTGGAGCCCCCGGCTGGGGAGG + Intronic
1049778401 8:144416568-144416590 GCTGGGGGACCCGTCGGGTGGGG + Intronic
1050463634 9:5897959-5897981 TCTAGGGGCCACACCTGGTGAGG + Intronic
1050831329 9:10017930-10017952 TCTGGGGACCCCTGCTGTTCTGG - Intronic
1057172482 9:92971375-92971397 TCTGGGGACCCGGGCTGCTTGGG + Intronic
1057315947 9:93968603-93968625 GCTGGGGGCCTGGGCTGGTCTGG - Intergenic
1057646264 9:96877610-96877632 TCTGGGGGCCCCGTGGGCTGGGG + Intergenic
1059657322 9:116368574-116368596 TCTGGGGGCCCCAGTTGATTGGG - Intronic
1060112249 9:120914581-120914603 TCTGGTTGCCCCGACTGGTCGGG + Intronic
1060532494 9:124356064-124356086 TCTGGGAGCCCGGGCAGGTCAGG - Intronic
1060813752 9:126624252-126624274 TCGGGGTGCCCCGCCAGGTGGGG + Intronic
1061110957 9:128570689-128570711 TCTTGTTGCCCCGGCTGGAGTGG + Intronic
1062209480 9:135356013-135356035 GCCGGGGGCTCCGGCTGGGGAGG - Intergenic
1062442354 9:136576455-136576477 CCTGGGAGCCCAGGGTGGTGGGG + Intergenic
1203736655 Un_GL000216v2:144208-144230 TCTGGAGGCATGGGCTGGTGAGG - Intergenic
1188107921 X:26165201-26165223 TCTGGGGACTCCAGGTGGTGAGG + Intergenic
1188111315 X:26198458-26198480 TCTGGGGACTCCAGGTGGTGAGG + Intergenic
1192620291 X:72672392-72672414 TCAAGGGGCCCCATCTGGTGAGG + Intronic
1197183545 X:123562457-123562479 GCTGGCTGCCCCGGCTGGTCAGG - Intergenic
1198286174 X:135194362-135194384 TCTGGGAGCCCCTGCTGCTGTGG + Intergenic
1200100691 X:153688102-153688124 TCCGCGGGCCCCGGCCGGGGCGG + Exonic
1200217265 X:154373578-154373600 TCTGAGGGCCAGGGGTGGTGTGG - Intronic
1201175852 Y:11307909-11307931 TCCGGGGGCACGGGCTGGCGAGG - Intergenic
1201178235 Y:11322551-11322573 TCCGGGGGCGCGGGCTGGCGAGG - Intergenic