ID: 1161982535

View in Genome Browser
Species Human (GRCh38)
Location 19:7637396-7637418
Sequence CCCTTTGGGTCCCCGGAGTC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 138
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 129}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161982535_1161982545 -1 Left 1161982535 19:7637396-7637418 CCGGACTCCGGGGACCCAAAGGG 0: 1
1: 0
2: 0
3: 8
4: 129
Right 1161982545 19:7637418-7637440 GGACGGGTAGAGTGTGGCGGAGG 0: 1
1: 0
2: 0
3: 9
4: 178
1161982535_1161982553 28 Left 1161982535 19:7637396-7637418 CCGGACTCCGGGGACCCAAAGGG 0: 1
1: 0
2: 0
3: 8
4: 129
Right 1161982553 19:7637447-7637469 CCCGGACTCCTGGGCCTCCTAGG 0: 1
1: 0
2: 3
3: 33
4: 348
1161982535_1161982550 18 Left 1161982535 19:7637396-7637418 CCGGACTCCGGGGACCCAAAGGG 0: 1
1: 0
2: 0
3: 8
4: 129
Right 1161982550 19:7637437-7637459 GAGGCTGGGGCCCGGACTCCTGG 0: 1
1: 5
2: 82
3: 185
4: 559
1161982535_1161982546 3 Left 1161982535 19:7637396-7637418 CCGGACTCCGGGGACCCAAAGGG 0: 1
1: 0
2: 0
3: 8
4: 129
Right 1161982546 19:7637422-7637444 GGGTAGAGTGTGGCGGAGGCTGG 0: 1
1: 0
2: 0
3: 45
4: 381
1161982535_1161982555 29 Left 1161982535 19:7637396-7637418 CCGGACTCCGGGGACCCAAAGGG 0: 1
1: 0
2: 0
3: 8
4: 129
Right 1161982555 19:7637448-7637470 CCGGACTCCTGGGCCTCCTAGGG 0: 1
1: 0
2: 0
3: 15
4: 198
1161982535_1161982548 5 Left 1161982535 19:7637396-7637418 CCGGACTCCGGGGACCCAAAGGG 0: 1
1: 0
2: 0
3: 8
4: 129
Right 1161982548 19:7637424-7637446 GTAGAGTGTGGCGGAGGCTGGGG 0: 1
1: 0
2: 2
3: 40
4: 379
1161982535_1161982543 -7 Left 1161982535 19:7637396-7637418 CCGGACTCCGGGGACCCAAAGGG 0: 1
1: 0
2: 0
3: 8
4: 129
Right 1161982543 19:7637412-7637434 CAAAGGGGACGGGTAGAGTGTGG 0: 1
1: 0
2: 1
3: 12
4: 220
1161982535_1161982549 10 Left 1161982535 19:7637396-7637418 CCGGACTCCGGGGACCCAAAGGG 0: 1
1: 0
2: 0
3: 8
4: 129
Right 1161982549 19:7637429-7637451 GTGTGGCGGAGGCTGGGGCCCGG 0: 1
1: 0
2: 10
3: 60
4: 986
1161982535_1161982544 -4 Left 1161982535 19:7637396-7637418 CCGGACTCCGGGGACCCAAAGGG 0: 1
1: 0
2: 0
3: 8
4: 129
Right 1161982544 19:7637415-7637437 AGGGGACGGGTAGAGTGTGGCGG 0: 1
1: 0
2: 1
3: 31
4: 424
1161982535_1161982547 4 Left 1161982535 19:7637396-7637418 CCGGACTCCGGGGACCCAAAGGG 0: 1
1: 0
2: 0
3: 8
4: 129
Right 1161982547 19:7637423-7637445 GGTAGAGTGTGGCGGAGGCTGGG 0: 1
1: 0
2: 1
3: 52
4: 283
1161982535_1161982551 19 Left 1161982535 19:7637396-7637418 CCGGACTCCGGGGACCCAAAGGG 0: 1
1: 0
2: 0
3: 8
4: 129
Right 1161982551 19:7637438-7637460 AGGCTGGGGCCCGGACTCCTGGG 0: 1
1: 7
2: 71
3: 153
4: 444

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161982535 Original CRISPR CCCTTTGGGTCCCCGGAGTC CGG (reversed) Intronic
901053513 1:6437778-6437800 GCCTTGGGGTCTCAGGAGTCAGG + Intronic
902480764 1:16710366-16710388 GCCTTGGGGTCTCAGGAGTCAGG - Intergenic
903339879 1:22647242-22647264 CCCTTTGGGTCCTCGGATCCCGG - Exonic
904336925 1:29803828-29803850 CCCCTTGGGTCCCCAGAGACAGG + Intergenic
906124092 1:43415975-43415997 CCCAGTAGGTCCCCTGAGTCTGG - Exonic
906984462 1:50668237-50668259 GCATTTGGGGCCCTGGAGTCAGG + Intronic
911356967 1:96834458-96834480 CCCTTTGGGTCCCTGGTCACTGG - Intergenic
913384149 1:118241373-118241395 CCCCCTGAGTCCCCGAAGTCTGG - Intergenic
913461282 1:119088574-119088596 CCCTTTGGCTCCCAGCAGTTTGG + Intronic
916218507 1:162419894-162419916 CCCAGAGGGTACCCGGAGTCCGG - Intergenic
922596970 1:226821601-226821623 CCCTTCCTGTCCCCTGAGTCTGG - Intergenic
924946463 1:248850159-248850181 CCTTTTCAGTCCCTGGAGTCTGG + Exonic
1065236550 10:23658246-23658268 CCCTTTGGGTTCCCCCAGGCAGG + Intergenic
1067703250 10:48588745-48588767 CCCTGTGGGGTCCCGCAGTCTGG + Intronic
1067945513 10:50685969-50685991 CCCTGTGGGTTCCCAGAGCCTGG - Intergenic
1069596915 10:69678003-69678025 CCCTTTGTCTCCCCAGAGTGGGG + Intergenic
1070867026 10:79712842-79712864 CCCTGTGGGTTCCCAGAGCCTGG - Intronic
1070880816 10:79850963-79850985 CCCTGTGGGTTCCCAGAGCCTGG - Intergenic
1071633938 10:87235065-87235087 CCCTGTGGGTTCCCAGAGCCTGG - Intronic
1075742095 10:124702106-124702128 CACCCTGGGTCCCCAGAGTCAGG - Intronic
1077121181 11:909376-909398 CCCTTTGGGTGACCAGGGTCGGG - Intronic
1077133123 11:984578-984600 TTCTTTGGGTCCCCGCAGTAGGG + Intronic
1080857726 11:36126570-36126592 GCCTTTGGGGCAGCGGAGTCTGG + Intronic
1083792353 11:64994223-64994245 CCCTTTGTGTCCCTGGAGCCTGG + Intronic
1085047095 11:73359967-73359989 CCCTCTGGCTCCCCAGTGTCAGG - Intronic
1086003080 11:82003172-82003194 CCGTGTGGGGCCCCCGAGTCTGG + Intergenic
1091416906 12:295737-295759 CCCTTTGGTGCCCCGAAGTTTGG - Exonic
1094084664 12:26576561-26576583 CCTTTTGGGTCCCCACATTCTGG - Intronic
1105454383 13:20526537-20526559 TCCTTTGTTTCCCCTGAGTCAGG + Intergenic
1107774404 13:43822895-43822917 CCCTTGGGGTCCCCGGTTCCAGG - Intergenic
1108548630 13:51521318-51521340 CCCTTAGAGTCCCTGGACTCTGG - Intergenic
1114212295 14:20625698-20625720 CCATTTGGGTTCCCGCAATCAGG + Intergenic
1120036801 14:79706978-79707000 CCCGTAGGGTACCCGAAGTCCGG - Intronic
1122599570 14:102914623-102914645 CCCTTTGGCTCCCTGGGGTCTGG - Intergenic
1123887025 15:24736214-24736236 CCCTTTGGGTCCCCTGTCTTGGG - Intergenic
1128082353 15:64864202-64864224 CCCTATTGGTCCCTGGAGCCTGG + Intronic
1128452907 15:67817269-67817291 CCCTTGGGGTCGGTGGAGTCGGG + Intergenic
1129410092 15:75345974-75345996 CACTTTGGGACCCCGAGGTCGGG + Intergenic
1131389588 15:92035883-92035905 CAATTTGGGTCCCTGGAGGCTGG + Intronic
1134149701 16:11796599-11796621 GCCTTGGGGTCCGCGGAGGCGGG - Intronic
1134338011 16:13319253-13319275 CACTTTGGGTCGCCTGAGGCAGG - Intergenic
1134664993 16:16012338-16012360 CCCTTTGTGTCCTCAGAGCCTGG + Intronic
1135075937 16:19393607-19393629 CCCAGTGGGTACCCTGAGTCTGG + Intergenic
1135618838 16:23935468-23935490 TCCTTTGGGTCCCTGCAGTTTGG - Intronic
1136413685 16:30091308-30091330 CTCTTTGGGGCCCTGGAGTTGGG + Intronic
1137567043 16:49539819-49539841 TCCTTTGGGACCCCAGAGTGGGG + Intronic
1141724216 16:85775672-85775694 CCCTCTCGGCCCCCGGAGGCAGG - Intronic
1141770558 16:86087257-86087279 GCCAATGGGCCCCCGGAGTCCGG - Intergenic
1142693567 17:1621243-1621265 CCCTTTGTCTCCCCGGGGTGTGG - Intronic
1143594814 17:7907720-7907742 CCCTCTGGGACCCAGGTGTCCGG - Intronic
1144109824 17:12020953-12020975 CCCGTAGGGTCCCCGGCGCCAGG + Exonic
1149589705 17:57819300-57819322 CTGTTTGGGTCCCTTGAGTCAGG - Intergenic
1151582380 17:74987799-74987821 CCCTTTGTGTCGCCGCAGCCCGG + Exonic
1153563801 18:6398908-6398930 CCCTTGGGGTCCTCAGAGGCTGG - Intronic
1155184162 18:23372831-23372853 CTCTTTGTGTCCCCAGAGCCTGG + Intronic
1155973577 18:32104256-32104278 CCCTTTGGGACGCCGAAGTGGGG - Intronic
1157729619 18:49992199-49992221 CTCTTTGGGTCCAGGGAGTGGGG + Intronic
1161982535 19:7637396-7637418 CCCTTTGGGTCCCCGGAGTCCGG - Intronic
1163548462 19:17952425-17952447 CCCTTTGAATTCCCGGAGTCGGG - Intronic
1165258609 19:34595190-34595212 CCCGTAGGGTACCCGAAGTCTGG + Exonic
1166455651 19:42937875-42937897 CTCTTTGGCTCCCTGGGGTCTGG + Intronic
1168278063 19:55287869-55287891 TCCTTTGGGTCACCAGAGTTTGG - Intronic
926704256 2:15825727-15825749 CCCTGTGGGTCCCTGGAGAGGGG + Intergenic
931632183 2:64311389-64311411 CTCTTTGGCACCCAGGAGTCCGG + Intergenic
932702482 2:74001247-74001269 CCCTTTGGGCCCCCGGGGAGGGG + Intronic
933418910 2:82023196-82023218 CCCAGTGGGTACCCTGAGTCTGG - Intergenic
933419855 2:82031232-82031254 CCCAGTGGGTACCCTGAGTCTGG - Intergenic
933521896 2:83384360-83384382 CCCTTAGGGTCCCTGGAGTGAGG - Intergenic
936433573 2:112483876-112483898 CCCTTTGGTTAACCGGTGTCAGG + Intronic
937715155 2:125024234-125024256 CCCAGTGGGTACCCTGAGTCCGG + Intergenic
940625734 2:156172830-156172852 GCCTCTGGGTCCCTGTAGTCTGG - Intergenic
940995422 2:160144340-160144362 CCCTTTTGTTTCCCTGAGTCAGG + Intronic
942830989 2:180237390-180237412 CCCAGCGGGTACCCGGAGTCTGG - Intergenic
943645615 2:190406263-190406285 CTGTTTGGGACCCCAGAGTCTGG + Intergenic
946084158 2:217154331-217154353 CCCTTGGGGTCCCTGCATTCCGG + Intergenic
946626694 2:221619740-221619762 CCCTCTGGGTCCCCAGGCTCAGG + Intergenic
948540215 2:238685960-238685982 CCCTTTAGATCCCAGGACTCTGG - Intergenic
948695756 2:239732313-239732335 CCCTGTGGGTCCAAGGAGGCAGG - Intergenic
1170335627 20:15267418-15267440 ACCTTTGTGTCCCCAGAGCCTGG + Intronic
1170335635 20:15267472-15267494 ACCTTTGTCTCCCCAGAGTCTGG + Intronic
1171121445 20:22572411-22572433 CACTCTGTGTCCCCGGAGCCTGG + Intergenic
1171155185 20:22865491-22865513 CCTCTTGGGTCACCAGAGTCGGG - Intergenic
1173926658 20:46786063-46786085 CCCTCAGTGTCCCTGGAGTCTGG + Intergenic
1184452926 22:44593500-44593522 GCCTTTGTGTCCCCAGGGTCTGG - Intergenic
1184513358 22:44945798-44945820 CCCTTTGGAGCCCCAGACTCAGG - Intronic
1184548333 22:45189239-45189261 CCCGTAGGGTACCCGAAGTCTGG - Intergenic
1185351418 22:50341596-50341618 CCCTGTAGGTCTCAGGAGTCAGG + Intergenic
949777716 3:7651126-7651148 CCCTTTGGGTCCCTGAACTCTGG - Intronic
949903848 3:8842136-8842158 CCCTTTTGTTCTCCCGAGTCAGG - Intronic
952933602 3:38378323-38378345 TCCTTTGTGTCCCCGGTGCCTGG - Intronic
955419793 3:58724789-58724811 CCCGTAGGGTACCCGAAGTCCGG - Intronic
956326047 3:68054253-68054275 CCCTTTGGGAGCCAGGGGTCAGG + Intronic
960967601 3:123116078-123116100 CCTTTTGTGTCCCCAGGGTCTGG + Intronic
962171340 3:133104680-133104702 CCCTTTGGTTCCCTGAAGCCTGG + Intronic
962237818 3:133723284-133723306 ACCTTTGGGTCTCCTGAATCTGG + Intergenic
962754763 3:138458944-138458966 CCCTGTGGGTCCCTGCATTCAGG - Intronic
963375393 3:144457610-144457632 CCCATGGGGTCCCCTGAGGCTGG - Intergenic
965919692 3:173897015-173897037 CCTTTTGGGACCCCGGAAACAGG - Intronic
967812449 3:193772249-193772271 CCCTTTGGCTCCCAGGACACAGG - Intergenic
968519043 4:1027496-1027518 CCCACTGCGTCCCCGGAGCCTGG + Intergenic
968808783 4:2790887-2790909 CATCTTGGGTCCCCGGGGTCTGG + Intergenic
969843368 4:9900282-9900304 TCCTTTGGCTCCCCTGTGTCCGG - Intronic
976306544 4:83565694-83565716 CCCGGTGGGTACCCCGAGTCCGG + Intronic
983410087 4:167385677-167385699 CCCTTTGGGTGCCATGAGTAAGG - Intergenic
990041483 5:51383026-51383048 CTCCTGGGGTCCCCGCAGTCCGG - Intergenic
991732605 5:69603930-69603952 CCCTTAGGGTGGCCGGAGGCTGG - Intergenic
991862348 5:71023922-71023944 CCCTTAGGGTGGCCGGAGGCTGG + Intronic
997412708 5:133702474-133702496 TCCATGGGGCCCCCGGAGTCCGG + Intergenic
1001919260 5:175587638-175587660 CACTTTGGGTCGCCTGAGGCGGG - Intergenic
1004320623 6:14628845-14628867 CCTTTCTGGTCCCCAGAGTCCGG + Intergenic
1006134266 6:31886535-31886557 CCCTCTGGGTCCCTGGTGCCTGG - Intronic
1016032571 6:139353076-139353098 GCCTTTAGCTCCCCGGACTCAGG + Intergenic
1018920369 6:168168195-168168217 CCCCCTGGGTCCCCTGAGGCTGG - Intergenic
1019467842 7:1200123-1200145 CCCTTGGGGGGCCCCGAGTCGGG - Intergenic
1029145589 7:98443518-98443540 CCCTGTGGGTGCCTGGTGTCAGG + Intergenic
1033125026 7:138699875-138699897 CCGGGTGGGTCCCCGGTGTCAGG + Intronic
1034538988 7:151744174-151744196 TGTTTTGGGTCACCGGAGTCTGG - Intronic
1034820989 7:154216139-154216161 CCCGTGGGGTCCCTGGAGCCAGG - Intronic
1036432302 8:8702288-8702310 GACTTCGGGTCCCCGGAGCCTGG + Exonic
1039551599 8:38447174-38447196 CCCTTTGTCTCACAGGAGTCAGG - Intronic
1048949848 8:139487255-139487277 CCCTTGGGCTCCACTGAGTCTGG - Intergenic
1049232819 8:141493052-141493074 CCCTCTGTGTCCCAGGAGGCGGG + Intergenic
1049343210 8:142124816-142124838 CCCCTGGGGTCCCCTGAGGCTGG + Intergenic
1049576692 8:143392991-143393013 GCCTCTGGGACCCCGGAGCCAGG - Intergenic
1060934002 9:127505607-127505629 CCTTTTGGGTCCCCGAGGTGGGG - Exonic
1061130825 9:128706803-128706825 GCCAGTGGGTCCCCGGAGCCAGG + Exonic
1061759689 9:132841927-132841949 CCCCTTGGGACCCCGGGTTCAGG - Intronic
1061779531 9:132987496-132987518 CCCCTTGGGGCCCTGGAGTCAGG + Intronic
1062060567 9:134493193-134493215 CCCTTTGAGACCCCGGTGTTTGG + Intergenic
1062116994 9:134814849-134814871 GCCTTTGGGTCCAGGGGGTCCGG - Exonic
1062443235 9:136582862-136582884 CCCTTAAGGTGCCTGGAGTCAGG + Intergenic
1062696544 9:137878749-137878771 CCCCTCGGGGCCCTGGAGTCGGG + Intronic
1189281057 X:39820590-39820612 GCCCTCGGGTTCCCGGAGTCTGG + Intergenic
1190261634 X:48801475-48801497 CCCTTCGGGTCGGCGGTGTCTGG - Intronic
1193337372 X:80306709-80306731 CTCTTGGGGTCCCCTGTGTCAGG - Intergenic
1199699525 X:150365154-150365176 CCCTTTGTTTCCCAGGAGGCTGG + Intronic
1201783215 Y:17745357-17745379 CCCAGTGGGTACCCTGAGTCTGG - Intergenic
1201818338 Y:18160630-18160652 CCCAGTGGGTACCCTGAGTCTGG + Intergenic