ID: 1161986151

View in Genome Browser
Species Human (GRCh38)
Location 19:7655604-7655626
Sequence GGGCCAGCAGCAGTGGTGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161986145_1161986151 1 Left 1161986145 19:7655580-7655602 CCAGAGAAATTAAAGCTGCGGGC No data
Right 1161986151 19:7655604-7655626 GGGCCAGCAGCAGTGGTGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161986151 Original CRISPR GGGCCAGCAGCAGTGGTGGT GGG Intergenic
No off target data available for this crispr