ID: 1161988498

View in Genome Browser
Species Human (GRCh38)
Location 19:7670532-7670554
Sequence GTGGGGCGCGTAGCTGCTGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 146
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 136}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161988492_1161988498 8 Left 1161988492 19:7670501-7670523 CCGGAGGGACTGATCTAGCGTCT 0: 1
1: 0
2: 0
3: 3
4: 48
Right 1161988498 19:7670532-7670554 GTGGGGCGCGTAGCTGCTGGAGG 0: 1
1: 0
2: 0
3: 9
4: 136
1161988491_1161988498 9 Left 1161988491 19:7670500-7670522 CCCGGAGGGACTGATCTAGCGTC 0: 1
1: 0
2: 0
3: 1
4: 38
Right 1161988498 19:7670532-7670554 GTGGGGCGCGTAGCTGCTGGAGG 0: 1
1: 0
2: 0
3: 9
4: 136

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161988498 Original CRISPR GTGGGGCGCGTAGCTGCTGG AGG Intergenic