ID: 1161990336

View in Genome Browser
Species Human (GRCh38)
Location 19:7681033-7681055
Sequence TTCTCCCCAGTGTAGAGGTA CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 321
Summary {0: 1, 1: 0, 2: 0, 3: 28, 4: 292}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161990326_1161990336 8 Left 1161990326 19:7681002-7681024 CCCCCCTCAGGAGGCTGCGAGGA 0: 1
1: 0
2: 2
3: 23
4: 211
Right 1161990336 19:7681033-7681055 TTCTCCCCAGTGTAGAGGTACGG 0: 1
1: 0
2: 0
3: 28
4: 292
1161990320_1161990336 27 Left 1161990320 19:7680983-7681005 CCGAGCCCGCTCGCTTCGGCCCC 0: 1
1: 0
2: 1
3: 11
4: 142
Right 1161990336 19:7681033-7681055 TTCTCCCCAGTGTAGAGGTACGG 0: 1
1: 0
2: 0
3: 28
4: 292
1161990330_1161990336 5 Left 1161990330 19:7681005-7681027 CCCTCAGGAGGCTGCGAGGAGGG 0: 1
1: 0
2: 4
3: 27
4: 255
Right 1161990336 19:7681033-7681055 TTCTCCCCAGTGTAGAGGTACGG 0: 1
1: 0
2: 0
3: 28
4: 292
1161990322_1161990336 21 Left 1161990322 19:7680989-7681011 CCGCTCGCTTCGGCCCCCCTCAG 0: 1
1: 0
2: 1
3: 133
4: 3557
Right 1161990336 19:7681033-7681055 TTCTCCCCAGTGTAGAGGTACGG 0: 1
1: 0
2: 0
3: 28
4: 292
1161990327_1161990336 7 Left 1161990327 19:7681003-7681025 CCCCCTCAGGAGGCTGCGAGGAG 0: 1
1: 0
2: 0
3: 26
4: 333
Right 1161990336 19:7681033-7681055 TTCTCCCCAGTGTAGAGGTACGG 0: 1
1: 0
2: 0
3: 28
4: 292
1161990321_1161990336 22 Left 1161990321 19:7680988-7681010 CCCGCTCGCTTCGGCCCCCCTCA 0: 1
1: 0
2: 0
3: 5
4: 138
Right 1161990336 19:7681033-7681055 TTCTCCCCAGTGTAGAGGTACGG 0: 1
1: 0
2: 0
3: 28
4: 292
1161990328_1161990336 6 Left 1161990328 19:7681004-7681026 CCCCTCAGGAGGCTGCGAGGAGG 0: 1
1: 0
2: 3
3: 46
4: 362
Right 1161990336 19:7681033-7681055 TTCTCCCCAGTGTAGAGGTACGG 0: 1
1: 0
2: 0
3: 28
4: 292
1161990319_1161990336 28 Left 1161990319 19:7680982-7681004 CCCGAGCCCGCTCGCTTCGGCCC 0: 1
1: 0
2: 1
3: 8
4: 132
Right 1161990336 19:7681033-7681055 TTCTCCCCAGTGTAGAGGTACGG 0: 1
1: 0
2: 0
3: 28
4: 292
1161990332_1161990336 4 Left 1161990332 19:7681006-7681028 CCTCAGGAGGCTGCGAGGAGGGT 0: 1
1: 0
2: 0
3: 34
4: 269
Right 1161990336 19:7681033-7681055 TTCTCCCCAGTGTAGAGGTACGG 0: 1
1: 0
2: 0
3: 28
4: 292

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161990336 Original CRISPR TTCTCCCCAGTGTAGAGGTA CGG Intronic
900689042 1:3968563-3968585 TTCTGCCCAGGGTAGAGGAAAGG - Intergenic
900779543 1:4608870-4608892 TTCACCCCACTGTGGAGATAGGG - Intergenic
901286815 1:8086891-8086913 TCCTCCTCAGTGTGGAGGTACGG + Intergenic
901856301 1:12046426-12046448 TTATCCCCAGTTTAGAGATGGGG + Intergenic
902883402 1:19387752-19387774 TTATCCCCATTTTACAGGTACGG - Intronic
902926831 1:19701475-19701497 TTTTCCCCATTTTAGAGTTAAGG + Intronic
903380673 1:22894999-22895021 TTCTCCCCATTTTACAGATAAGG + Intronic
903553912 1:24179673-24179695 TTTTCCCCATTCTAGAGGTGAGG - Intronic
903883177 1:26526000-26526022 TTCTCTCCAGTGTACAGATGGGG - Intergenic
904114480 1:28151491-28151513 TAATCCCCAGTGCAGAGGTGTGG + Intronic
904133519 1:28293024-28293046 TTCTCCCCATTTTAGAGATGGGG - Intergenic
904559944 1:31389671-31389693 TTATCCCCATTTTATAGGTAAGG + Intergenic
905345631 1:37309293-37309315 TTCTCCCCATTTTAGAGATGGGG + Intergenic
906274481 1:44506035-44506057 TGCTGCCCAGAGAAGAGGTAAGG - Intronic
906516583 1:46442711-46442733 CTCTCCCCAGGGTGGAGGGAAGG - Intergenic
907708721 1:56856315-56856337 TTCCTCCCATTGTACAGGTAAGG - Intronic
907959851 1:59268656-59268678 TTCTCCCCACTTTACAGATAAGG - Intergenic
908097684 1:60757445-60757467 TTCTCTCCATTTTACAGGTAAGG - Intergenic
911585001 1:99680345-99680367 TTTTCCCCAGTGAATAGGCAAGG + Intronic
912497604 1:110101599-110101621 TCCTCCCCAGTTTAGAGTTCAGG + Intergenic
912711470 1:111953039-111953061 TTATCCCCAGTGTACAAGTGAGG + Intronic
912770624 1:112461492-112461514 TTATCCCCAGTGTAGTGATGAGG + Intronic
912906180 1:113710120-113710142 TTATCCCCAGTTTAGAGGTGAGG - Intronic
914139890 1:144936581-144936603 TCCTCCCCAGGTTAGATGTAAGG - Intronic
914425712 1:147573668-147573690 TGCTCCCCATTTTAGAGATAAGG - Intronic
915182447 1:154074149-154074171 ATCTCTCCAGTATAAAGGTATGG + Intronic
916416209 1:164594124-164594146 TTATCCCCATTTTAGAGATAAGG + Intronic
916508321 1:165448248-165448270 TTTTGCCCACTGTAGGGGTACGG + Intergenic
917110614 1:171543467-171543489 TTCTCCCCATTTTAGCGGTGAGG - Intronic
917259197 1:173148661-173148683 TACTGCCCAGTGAAGAGGAATGG + Intergenic
917534787 1:175866464-175866486 TTATCCCCATTTTAAAGGTAAGG - Intergenic
917585980 1:176426539-176426561 TTCTGCCCAGTGAAGAGAAACGG + Intergenic
920113392 1:203602733-203602755 TTATCCCCATTTTACAGGTATGG + Intergenic
920485058 1:206362120-206362142 TCCTCCCCAGGTTAGATGTAAGG + Intronic
921070510 1:211654383-211654405 GTCTTCCCTGTGTAGAGGGAGGG + Intergenic
921168858 1:212527730-212527752 TTATCCCCACTGTATAGGTGAGG + Intergenic
923552742 1:234977183-234977205 TTCTGCTGAGGGTAGAGGTAAGG + Intergenic
924124644 1:240837682-240837704 ATTTCCCCAATGTAAAGGTAAGG + Intronic
1064304148 10:14150160-14150182 TAATCCCCAGTGTTGAGGGAGGG - Intronic
1064334700 10:14428431-14428453 TTCTTCACAGAGCAGAGGTAGGG + Intronic
1066027492 10:31376690-31376712 TTATCCCCATTTTACAGGTAAGG - Intronic
1068596061 10:58904590-58904612 TTCTGCCCAGTGAAGAGAAATGG - Intergenic
1072458442 10:95597742-95597764 CTCCCTCCAGTGTAGAGGTCTGG + Intergenic
1073199657 10:101725003-101725025 TCCTCCCCAGTGCACAGGTCAGG + Intergenic
1073458996 10:103654767-103654789 TTATCCCCATTTTACAGGTAAGG + Intronic
1073761758 10:106636672-106636694 TAATCCCCAGTGTCGAGGGAAGG - Intronic
1074963057 10:118465065-118465087 TAATCCCCAGTGTCGAGGGAGGG - Intergenic
1077755634 11:5025007-5025029 TTCCACCCAGTGTGGAGATATGG - Intergenic
1077984803 11:7341113-7341135 TTCTACCCAGTGAAGAGAAATGG + Intronic
1078896777 11:15603837-15603859 TGCTCCCCTGTGTAGAGGTGAGG + Intergenic
1079709201 11:23660529-23660551 TAATCCCCAGTGTAGGGGGAGGG + Intergenic
1079982680 11:27167743-27167765 TTCTCCCCAGTGACTAAGTATGG + Intergenic
1081218511 11:40431740-40431762 TTATCCCCATTTTACAGGTAAGG + Intronic
1081734903 11:45395837-45395859 TTCTACCCATTTTAGAGGTGAGG + Intergenic
1083008090 11:59367770-59367792 TCCTGCCCAGTGAAGAGGAATGG - Intergenic
1084035223 11:66505598-66505620 TTATCCCCATTTTACAGGTAAGG + Intronic
1087222332 11:95559977-95559999 TTCTGGCCAGTGAAGAGGTAAGG - Intergenic
1087708245 11:101520111-101520133 TAATCCCCAGTGTTGAGGAAGGG + Intronic
1090424630 11:126598803-126598825 TTATTCCCACTGCAGAGGTAAGG - Intronic
1090457955 11:126866187-126866209 TTCTCCGCAGTGTTTAGATAAGG - Intronic
1090484669 11:127102326-127102348 TTCTCCCCATTTTACAGGTGAGG - Intergenic
1091997899 12:5009474-5009496 TTATCTCCAGTGCAGAGGTTTGG + Intergenic
1092013474 12:5136851-5136873 TTATCCCCATTTTAGAGATAGGG - Intergenic
1092782878 12:12003627-12003649 TTCTCTCCAGAGCAGAGGGAAGG + Intergenic
1093690476 12:22103063-22103085 TTCTACCCAGTGAAGAGAAATGG + Intronic
1095242474 12:39877867-39877889 TAGTCCCCAGTGCTGAGGTAGGG + Intronic
1095967506 12:47878927-47878949 CTCTCCCCAGTGGAAAGGGAGGG - Intronic
1097122255 12:56743569-56743591 TTCTCCCCATCATAGAGATAAGG + Intronic
1098774209 12:74590588-74590610 TTCTCCCCAAATTAGAGATAAGG + Intergenic
1098922856 12:76318689-76318711 TTATCACCATTGTACAGGTAAGG + Intergenic
1100095377 12:91027476-91027498 TGATCCCCATTGTGGAGGTAGGG + Intergenic
1100838601 12:98590183-98590205 ATCTCCACAGTGGAGAGTTATGG + Intergenic
1101354995 12:103968447-103968469 TTCTCCCCAGTCTACTGGCATGG + Intronic
1101651345 12:106680257-106680279 AGCTCCCCAGTGTAGAGAAATGG + Intronic
1101722509 12:107362387-107362409 ATCTCCCCAGGGAAGACGTAAGG + Intronic
1101875914 12:108596997-108597019 TTATCCCCATTGTACAGATATGG - Intronic
1104245997 12:127041951-127041973 TCATCCCCAGTGTTGAGGTGGGG - Intergenic
1104370047 12:128216399-128216421 TAATCCCCAGTGTTGAGGTGGGG + Intergenic
1107416514 13:40206267-40206289 TTCTTCCCAGAGCAGAGGTAGGG - Intergenic
1108479419 13:50853342-50853364 TTATCCCCAGTTTACAGATAAGG - Intergenic
1111342925 13:86911965-86911987 TTATCCACAGAGCAGAGGTAAGG + Intergenic
1112076176 13:95915818-95915840 TCCTCCCCAGTGAGGAGGAATGG - Intronic
1113459029 13:110468857-110468879 TTCTCCCCACTTTACAGGTGAGG + Intronic
1113684625 13:112274255-112274277 TTCTCCCCATTGTACAGGAGGGG - Intergenic
1113837286 13:113336648-113336670 GTGTTCCCAGTGCAGAGGTAGGG - Intronic
1114598573 14:23935149-23935171 TGATCCCCAGTGTGGAGGTGGGG - Intergenic
1114991699 14:28296615-28296637 TTCTGCTCAGTGGAGAGGAACGG + Intergenic
1117695244 14:58355242-58355264 TTTTTCCCAGTGTAGAGATGAGG - Intronic
1117838530 14:59832627-59832649 TTATGCCCAGTGTAGTGGTGAGG - Intronic
1118769553 14:68933049-68933071 TTCTCCCCACTTTAGAGATGAGG + Intronic
1120283098 14:82463898-82463920 TCCTGCCCAGTGTGGAGGAATGG - Intergenic
1120830446 14:88993152-88993174 TTGTCCCCATTGTAGAGATGAGG + Intergenic
1121803159 14:96792310-96792332 TTACCCCCAGTATAGAGATAAGG - Intergenic
1122719337 14:103713414-103713436 TTCACCCCGGTGTAGAGAGATGG - Intronic
1124148746 15:27157656-27157678 TTACCCTCAGTGTATAGGTAAGG - Intronic
1124161546 15:27274595-27274617 TGATCCCCAGTGTGGTGGTATGG - Intronic
1124659995 15:31539378-31539400 TTCTCCCAAGTGTAGACCTCGGG - Intronic
1124709726 15:31997643-31997665 TTCTCCCCAGTGCAGACGCAGGG - Intergenic
1125376819 15:39039066-39039088 CTCTCCCCAGTGCAGAGGTGGGG - Intergenic
1125546841 15:40512185-40512207 TTATCCCCAAAGTAGAGGTTTGG - Intergenic
1125586490 15:40824246-40824268 GTCTCCCTAGTGGAGAGGTCAGG - Intronic
1127519239 15:59726980-59727002 TTCTCCCCATTTTACAGGCAAGG - Intergenic
1127597538 15:60501453-60501475 TTATCCCAATTTTAGAGGTAAGG + Intronic
1128772407 15:70292123-70292145 TTTTCCCCATTGTACAGGCAAGG + Intergenic
1129190144 15:73932557-73932579 CTCTCCCCAGTGTGGGGTTAGGG + Intronic
1129356424 15:74995243-74995265 TTCTCCCCAGTTTACAGATATGG + Intronic
1129661982 15:77558012-77558034 GTCTGCCCAGTGTGGAGGTCAGG + Intergenic
1130120538 15:81043729-81043751 TTATCCCCATTTTAGAGGTGAGG + Intronic
1130185478 15:81677363-81677385 TTCTGCCCAGTGAAAAGGAACGG - Intergenic
1130620176 15:85453845-85453867 TCCTACCCAGTGAAGAGGAATGG + Intronic
1132075339 15:98815407-98815429 CTCTCCCCACTGTAGAAGGATGG - Intronic
1132231163 15:100185214-100185236 TTCTCTCCATTCTACAGGTAGGG - Intronic
1134260150 16:12644603-12644625 TTGTCCCCACTTTACAGGTAAGG - Intergenic
1140218043 16:73023931-73023953 TTCTACCCAGTCTACAGATAGGG - Intronic
1142975905 17:3644240-3644262 TTCTCCCCACTGTACAGATAAGG + Intronic
1143898557 17:10156198-10156220 GGCTCCCCAGGGTAGAGGTTTGG - Intronic
1145783708 17:27580665-27580687 TTCTCCCCAGTGTACAGTGGAGG - Intronic
1146267594 17:31463295-31463317 TTGTGCCCAGTTTACAGGTAGGG - Intronic
1147473032 17:40682164-40682186 TTATCCCCAGTTTACAGATAAGG - Intergenic
1147685445 17:42284179-42284201 TTCTCCCCAGGGTAGGGGCATGG + Intergenic
1147945739 17:44079138-44079160 CTCTGCTCAGTGTAGAGGTAAGG - Exonic
1149945925 17:60927124-60927146 TATTCCCCACTGTAGATGTATGG + Intronic
1150144542 17:62756701-62756723 TTCTCCCCATTGTACAGATGAGG + Intronic
1151868096 17:76818187-76818209 TAATCCCCAGTGTTGAGGGAGGG - Intergenic
1152248634 17:79199853-79199875 TTCTCCCCATTTTATAGATAAGG - Intronic
1152553169 17:81039921-81039943 TTCTCCCCAGTTCACAGGTCTGG + Intronic
1153124799 18:1778196-1778218 TTCTTCCCAGTCCAGAAGTATGG - Intergenic
1155500827 18:26485251-26485273 TTATCCCCATTTTAGAGGCAAGG + Intronic
1156446243 18:37239175-37239197 TTATCCCCATTTTAGAGATAAGG + Intergenic
1157645463 18:49264873-49264895 TTCTCCAGATTATAGAGGTATGG - Intronic
1158488559 18:57889688-57889710 TTATCCCCATTTTAAAGGTAAGG - Intergenic
1158643873 18:59226565-59226587 TTCTCTCCATTTTAGAGGTAAGG + Intronic
1161990336 19:7681033-7681055 TTCTCCCCAGTGTAGAGGTACGG + Intronic
1163327341 19:16613568-16613590 TGCTGCCCACTGTAGAGGGAAGG - Intronic
1164603261 19:29577822-29577844 TTCTCCCCAGTGGAAGGGAACGG + Intergenic
927050842 2:19327092-19327114 TTCTGCCCCTTGTAGAGGGAAGG - Intergenic
928259256 2:29751961-29751983 TTATCCCCATTTTAGAGGTAAGG + Intronic
929828038 2:45325295-45325317 TTCTCTGCAGTGAAGAGCTATGG - Intergenic
930939584 2:56997917-56997939 TTCTACCCAGTGAAGAGGAATGG + Intergenic
931127281 2:59292194-59292216 TTCTTCCCAGTGCTGATGTAAGG + Intergenic
933291795 2:80445957-80445979 TACTCCCCATTTTACAGGTAAGG - Intronic
938368977 2:130756739-130756761 GTCTCCCCAGTGTGGGGGTTGGG + Intronic
938718042 2:134039043-134039065 TAATCCCCAGTGTTGAGGTAGGG - Intergenic
938810121 2:134845218-134845240 TTCTCCCCACTGCAGAGGTTTGG + Exonic
940615010 2:156038772-156038794 TTCTGCCCAGTGAAGATGAATGG - Intergenic
941653692 2:168120894-168120916 TTCTAGCAAGTGTAGAGGGAAGG - Intronic
941891041 2:170582299-170582321 TTCTTTCCAGAGTAGAAGTAGGG - Intronic
943572072 2:189585455-189585477 TTATCCCCAGTGTACATATAAGG + Intergenic
943823377 2:192356614-192356636 TGCTCCCCAGTGGAGAAATAAGG - Intergenic
944427638 2:199599912-199599934 TTATCCCCATTGTAGAGATGAGG - Intergenic
946282131 2:218673149-218673171 TTATCCCCATTCTAGAGATAAGG - Intronic
947375103 2:229487982-229488004 TTCTGCACAGAGTAGAGGCATGG + Intronic
1169630627 20:7626577-7626599 TTCTGCCCTGTGTAGACTTAAGG - Intergenic
1170365356 20:15592152-15592174 TTATCCCCATTTTATAGGTAAGG - Intronic
1171239321 20:23552165-23552187 TTCTCCCCAGTGTTCAGGCCTGG + Intergenic
1172090572 20:32429102-32429124 TTATCCCCATTTTACAGGTAAGG - Intronic
1173305336 20:41842200-41842222 TAATCCCCAGTGTTGAGGAAGGG - Intergenic
1174116628 20:48230818-48230840 TTCTCCCCAGTGTAGCGGGGTGG + Intergenic
1174133950 20:48365903-48365925 TTCTCTCCAGTGAAGATGTCAGG + Intergenic
1174565913 20:51464347-51464369 TTCTCCCCATTTTACAGATAGGG + Intronic
1176963629 21:15187762-15187784 TAATCCCCAGTGTGGAGGTGGGG - Intergenic
1176979072 21:15358499-15358521 CTCTCCCCAGTGAATATGTATGG - Intergenic
1177125947 21:17192959-17192981 TTCTTCCCAGTGAAGTGGGAAGG - Intergenic
1178126909 21:29526030-29526052 TAATCCCCAGTGTTGAGGGAGGG - Intronic
1178436909 21:32567726-32567748 TTCTCCCCAGTGGTTAGCTAGGG + Intergenic
1178718732 21:34989869-34989891 TTCTCCCCAGTGTACAGATGTGG - Intronic
1181711665 22:24695373-24695395 TTCACCCCAGGCTAGGGGTAGGG - Intergenic
1181871062 22:25899710-25899732 TTTTCCCCACTGCAGGGGTAAGG - Intronic
1182107629 22:27700665-27700687 TTCTCCCCAGTGTAGACAGAGGG + Intergenic
1183280733 22:36930683-36930705 TGCTCCCCAGTGCTGAGGGAGGG + Exonic
950308784 3:11937730-11937752 TTATCCCCAGTCTACAGATAAGG + Intergenic
950672603 3:14536282-14536304 TTGTCCCCAGTTTACAGATAGGG + Intronic
951104324 3:18725297-18725319 TATTCCCCAGTGTAGAACTAAGG - Intergenic
951225055 3:20111239-20111261 TTGTCCCCATTTTACAGGTAAGG + Intronic
954156903 3:48690461-48690483 CCCTCCCCTTTGTAGAGGTAAGG - Intronic
955324748 3:58001280-58001302 TTATCCCCATTTTACAGGTAAGG - Intergenic
955887741 3:63618725-63618747 TTATCCCCACTGTAGAGATGGGG - Intergenic
956739611 3:72265390-72265412 TCCTCCCCAGGGTAGATGTCAGG - Intergenic
956747211 3:72319556-72319578 TTATCCCCATTTTACAGGTAGGG - Intergenic
958884730 3:99713162-99713184 TTGTCCCCAGTTTACAGATAAGG + Intronic
962792506 3:138824326-138824348 TTCTCCCCAGTGTAAACCCAAGG - Intronic
963057056 3:141194372-141194394 TTCTGCCCAGTGAGGAGGAACGG - Intergenic
964019203 3:151986749-151986771 TTTTCTACAGTGGAGAGGTAAGG - Intergenic
964614424 3:158647135-158647157 TTGTCCCCATTTTAGAGATAAGG - Intronic
964814782 3:160705221-160705243 TTATACCCATTTTAGAGGTAAGG - Intergenic
966179469 3:177174756-177174778 TTCTCCCCTGTCCAGAGCTAAGG + Intronic
966243717 3:177782455-177782477 TTCTCGCCTGAGTAGAGGTGTGG + Intergenic
966422680 3:179748877-179748899 TTATCCCCAGTTTACAGATAGGG - Intronic
966454788 3:180102513-180102535 TCCTGCCCAGTGAAGAGGAATGG - Intergenic
966572632 3:181462947-181462969 TTCTCATCAGTGTAGAAGTAGGG - Intergenic
967979348 3:195056322-195056344 TTATCCCCATTGTGCAGGTAGGG - Intergenic
968281980 3:197484241-197484263 TTCTCGCAAGGGTAGAGGGAAGG - Intergenic
970047196 4:11868144-11868166 TTCTCCCTAGCCTAGAGGTTGGG + Intergenic
971224470 4:24738180-24738202 TAATCCCCAGTGTTGAGGGAGGG + Intergenic
971635563 4:29052635-29052657 TTCACCCCATTGGAGAGGAAGGG - Intergenic
972726119 4:41747389-41747411 TCCTCCCGAGTGTAGATGTCGGG + Exonic
977319546 4:95495309-95495331 TTGTACCCAGTATAGAGGTCAGG + Intronic
978521455 4:109619896-109619918 TTATCCCCATTGTATAGATAAGG + Intronic
978830154 4:113074173-113074195 TTCTTCCCAGTGTACAAATATGG + Intronic
979940901 4:126761678-126761700 TTCTCCCAATTTTAGAGTTAAGG + Intergenic
979968461 4:127105997-127106019 TTCTGCCCAGTGAGGAGGAATGG - Intergenic
981020421 4:140021937-140021959 TTATCCCCATTTTAGAGATATGG + Intronic
981853464 4:149258824-149258846 TTATTCCCAGTTTAGAAGTAAGG - Intergenic
983762950 4:171436462-171436484 TTCTCCACACTGTAGAAATATGG - Intergenic
983880110 4:172923420-172923442 ATTTCCCAAGTGTAGTGGTAGGG - Intronic
985031488 4:185794872-185794894 TTCTCCCCAGGCCAGAGGTCTGG - Intronic
985424040 4:189811314-189811336 TTCTCCCCAGTGTAGCAGAGTGG + Intergenic
987488573 5:18549924-18549946 TAATCCCCAATGTAGAGGAAGGG - Intergenic
988690577 5:33567995-33568017 TTTTCCCTATTGTAGAGGCAAGG - Intronic
989106269 5:37866061-37866083 TTATCCCCATTGCACAGGTAGGG - Intergenic
989146067 5:38251365-38251387 ATCTCCACAGAGTAGAGGTCAGG - Intergenic
991268159 5:64747244-64747266 TTCTCCCCTTTCTAGAGGTCTGG + Intronic
991592411 5:68266777-68266799 TTATCCCCAGTTTAAAGGCAAGG - Intronic
991953879 5:71972880-71972902 TTCTCCCCATTGTACAGATGAGG + Intergenic
992583054 5:78201883-78201905 TCCTCCCCTGTGTAGAGAGAGGG - Intronic
992806358 5:80341948-80341970 TTCTCTCCAGGGTAAAGGTTGGG + Intergenic
992956802 5:81918255-81918277 TTATCCCCATTTTACAGGTAAGG - Intergenic
994551315 5:101238865-101238887 TCCTCCCCAGTGAGGAGGAATGG + Intergenic
994614790 5:102090928-102090950 TGCTGCCCAGTGTACAAGTATGG + Intergenic
995174063 5:109153709-109153731 TTATCCCCAGTTTACAGATAAGG + Intronic
997205106 5:132043587-132043609 TTCTGCCCAGTGAGGAGGAATGG + Intergenic
998405404 5:141871525-141871547 TTATCCCCATTTTACAGGTAAGG - Intronic
999125842 5:149245190-149245212 TGCTCCCCAGTGTATTGCTAGGG - Intronic
999321926 5:150620748-150620770 TTCTCCCCATTTTACAGGTGAGG + Intronic
999616228 5:153427479-153427501 TTATCCCCAGTGAACAGATAAGG - Intergenic
999979941 5:156948410-156948432 TTCTCCTCAGCCTGGAGGTAGGG - Exonic
999997890 5:157109779-157109801 TTCTACTCAGAGTAGAGGAAAGG - Intronic
1000390574 5:160718809-160718831 TGATCCCCAGTGTAGCAGTATGG - Intronic
1000867073 5:166526972-166526994 TTCTCCACACTGTAGATTTAAGG + Intergenic
1001007017 5:168061218-168061240 TTTTCCCCATTTTAGAGATAAGG + Intronic
1001232592 5:170001566-170001588 TTCTCCCCATTTTAGAGATCAGG - Intronic
1001417254 5:171554836-171554858 TTCTCCCCGGTGAAGTGGGAAGG - Intergenic
1001961708 5:175883710-175883732 TTCTCCCCAGTGCAGAGCGTGGG - Exonic
1002792234 6:445108-445130 TCCTCCCCAGTGTTGTGGTTTGG - Intergenic
1004583848 6:16980249-16980271 TTCTCCCCACCGTAGAAGGATGG + Intergenic
1006425983 6:33963279-33963301 TTATCCCCATTCTAGAAGTAGGG - Intergenic
1006610232 6:35290211-35290233 TTCTCCCCAGTGAAGAAGGTGGG - Intronic
1007082554 6:39118358-39118380 TAATCCCCAGTGTGGAGGTGCGG + Intergenic
1007352677 6:41285378-41285400 TTCTCCCCATTTTATAGATAAGG + Intronic
1008172681 6:48228697-48228719 TTCTCCCCTGTGTATAGAGAAGG - Intergenic
1008484209 6:52017485-52017507 TCCTCGCAAATGTAGAGGTAAGG + Exonic
1009773172 6:68171037-68171059 TTCTGCCCAGGTTAGAGATAGGG + Intergenic
1010561663 6:77358623-77358645 TTCTTCACAGTGTGGAGGAATGG - Intergenic
1011370673 6:86633757-86633779 TTCTACCCAGTGAAGAGGAACGG + Intergenic
1011507989 6:88068500-88068522 TTCTGCCCAGTGAGGAGGAATGG + Intergenic
1015155917 6:130096169-130096191 TTCTCCCCAGTTGGGAAGTAAGG - Intronic
1015788475 6:136942636-136942658 CTCTTCTCAGTGTAGAGGGAAGG - Intergenic
1016020537 6:139232344-139232366 TAATCCCCAGTGTTGAGGGAGGG - Intergenic
1016641961 6:146359692-146359714 TTCTCCCCAGTTCAGGGGCAAGG + Intronic
1016702982 6:147074992-147075014 TTATCCCCATTTTAGAGGTGGGG - Intergenic
1017131757 6:151113856-151113878 TTATCCCCATTGTACAGATAAGG - Intergenic
1018144899 6:160877002-160877024 TTCTCCCCAGTGGTTAGCTAGGG - Intergenic
1018206644 6:161442929-161442951 TTCTCCCCAGTGCACAGATGAGG + Intronic
1019129149 6:169860684-169860706 TGATCCCCAGTGTCGAGGGAGGG + Intergenic
1019395963 7:817692-817714 TTCTCCACAGTGGAGATGTAGGG - Intronic
1019642232 7:2109930-2109952 TTCTCCACAGCGCAGAGGTCAGG + Intronic
1022414838 7:30168975-30168997 TCTTCCACAGTTTAGAGGTATGG - Intergenic
1023124620 7:36943126-36943148 TTGTCCCCAGTGTACAGATGTGG - Intronic
1024118236 7:46212802-46212824 GTCTCCCCAGTCTAGACGTGAGG + Intergenic
1026479788 7:70767729-70767751 TTCTCTCCTGTTTAGAGGTTTGG + Intronic
1026546747 7:71329782-71329804 TAATCCCCAGTGTTGGGGTAGGG - Intronic
1027450583 7:78326820-78326842 TCCTCCTCCGTGGAGAGGTATGG + Intronic
1028391485 7:90321771-90321793 TTTCCCCCAGTGTAGAAGCAAGG - Intergenic
1029927732 7:104335300-104335322 TTCTCCCATGTGTAGAGGAAAGG + Intronic
1030068309 7:105677339-105677361 TTGTCCCCATTTTACAGGTAAGG - Intronic
1030710813 7:112747113-112747135 GTGTCCCCAATTTAGAGGTAAGG - Intergenic
1034205442 7:149310644-149310666 TAATCCCCAGTGTTGGGGTAGGG + Intergenic
1035384918 7:158464948-158464970 TTATCCCCATTTTAGAGATAAGG + Intronic
1036199961 8:6762177-6762199 TTCTCCCCTCTTTACAGGTAAGG - Intergenic
1037433777 8:18841935-18841957 TTCAGACCAGTGGAGAGGTAGGG + Intronic
1038705364 8:29888543-29888565 TTGTACCCACTTTAGAGGTATGG - Intergenic
1038915844 8:32021534-32021556 TGATCCCCAGTGTGGAGGTAGGG - Intronic
1038996476 8:32928519-32928541 TTTTCCCCAGTTTACAGATAAGG + Intergenic
1039742979 8:40398935-40398957 TTCTCAGGAGTGTAGAGATAGGG + Intergenic
1041415955 8:57609138-57609160 TTCTCTCCAGTGTAGAAGAAAGG - Intergenic
1041608969 8:59821167-59821189 TTCTCCAGTGTGAAGAGGTAGGG + Intergenic
1042380884 8:68112794-68112816 TTTTCCCCATTTTAGAGGTGGGG - Intronic
1042529894 8:69803979-69804001 CTCTCCCCAGTGGTGAGGTGAGG - Intronic
1043567077 8:81560319-81560341 TTCTCTTGAGTTTAGAGGTAAGG - Intergenic
1043960813 8:86416658-86416680 TTCTACCTAGTGTTTAGGTATGG - Intronic
1044262550 8:90144053-90144075 TTCTCCACATTGTACAGGTGAGG + Intergenic
1044873626 8:96643632-96643654 TTCCCCCCACTGTACAGATAAGG - Intergenic
1048993452 8:139774784-139774806 ATCTCTCCAGTGGACAGGTAAGG + Intronic
1049213808 8:141398707-141398729 TTCTCCCCAGTGTCCAGGCCTGG + Intronic
1049415315 8:142492338-142492360 CTCTCCCCAGTGAGGAGGGATGG + Intronic
1054159748 9:61665513-61665535 CTCACCCCAGTGGAGAGGTCAGG - Intergenic
1054989429 9:71305469-71305491 TTTTCTCCAGTGTAAAGGTCTGG + Intronic
1055902797 9:81260559-81260581 TTATCCCCATTTTAGAGATAGGG + Intergenic
1056558914 9:87712514-87712536 TTCTCCTCAGGGTAGAGAGAAGG + Intergenic
1057713698 9:97470310-97470332 TTCTTCCCATTGAAGGGGTAGGG + Intronic
1057849834 9:98556692-98556714 TTCTCCCCATTTTACAGTTAAGG - Intronic
1058514116 9:105752106-105752128 TCCTCTCCAGTGAAGAGGAATGG - Intronic
1059708903 9:116849290-116849312 TTCTCCCCAGTTCAGAGGTTGGG + Intronic
1060103862 9:120861671-120861693 TTGTCCCCACTGTCCAGGTAGGG - Intronic
1060531326 9:124348570-124348592 TTATCCCCATTGTATAGGTGAGG - Intronic
1060545720 9:124458015-124458037 CTCTCCCCACTCTAGAGATAGGG - Intronic
1060913010 9:127365721-127365743 TTATCCCCAGTTTAGAGATGAGG + Intronic
1061200776 9:129137345-129137367 TTGTCCCCAGTGTCCAGGTGAGG + Intronic
1188398207 X:29711694-29711716 TTCCCCCCAGTGTAAAAGTTAGG + Intronic
1189025139 X:37386764-37386786 TTATCCCCACTTTACAGGTAAGG - Intronic
1190391176 X:49933304-49933326 TTCTCCCCACTGAAGAGTTATGG - Intronic
1190525711 X:51327599-51327621 GTCTCCGCAGTGTAGAGAAAAGG + Intergenic
1190752922 X:53377657-53377679 TTCTCCCCACTTTACAGATAAGG - Exonic
1192067784 X:67904357-67904379 TTCTGCCCAGTGAAGAGAAATGG + Intergenic
1192243802 X:69357204-69357226 TTTTCCCCATTTTACAGGTAAGG + Intergenic
1192718660 X:73669308-73669330 TTCTGCCCAGTGAGGAGGAATGG + Intronic
1192832725 X:74767467-74767489 TTCTGCCCAGTGAAGAGAAACGG + Intronic
1193325555 X:80175521-80175543 TTCTCTGCAGTGGAGAGGGAGGG - Intergenic
1194554085 X:95336677-95336699 TTCTCCACAGGGCAGAGGGATGG + Intergenic
1195397325 X:104425481-104425503 TTCTTGCCAGTGGAGAGGAAAGG - Intergenic
1195397942 X:104431169-104431191 TTCTCCCCATTTTACAGATAAGG - Intergenic
1195448961 X:104987844-104987866 GTCTCCCCAGGCAAGAGGTATGG + Intronic
1197760934 X:130027744-130027766 TTCTCCCCATTTTACAGATATGG + Intronic
1198107792 X:133477603-133477625 TTAGCCCCAGTTTAGAGGGAAGG - Intergenic
1198510888 X:137350434-137350456 TAATCCCCAGTGTTGAGGGAAGG + Intergenic
1198836439 X:140809802-140809824 TAATCCCCAGTGTTGAGGGAGGG - Intergenic
1199393971 X:147312428-147312450 TTCTGCCCAGTGAGGAGGAACGG - Intergenic
1199539739 X:148945735-148945757 TTATCCCCATTTTACAGGTAAGG + Intronic
1200344578 X:155435721-155435743 TTCTGCCCAGTGAGGAGGAATGG - Intergenic
1201390461 Y:13491655-13491677 TCCTCTCCTGTGTAGAGGTCTGG + Intergenic
1202596758 Y:26548422-26548444 TTCTGCCCAGTGAGGAGGAATGG - Intergenic