ID: 1161994386

View in Genome Browser
Species Human (GRCh38)
Location 19:7703596-7703618
Sequence CTGTGGGGATGGGGAGAAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161994386_1161994394 3 Left 1161994386 19:7703596-7703618 CCTGCTTCTCCCCATCCCCACAG No data
Right 1161994394 19:7703622-7703644 CTCCCTCTTCCCCCTGGACCAGG No data
1161994386_1161994402 21 Left 1161994386 19:7703596-7703618 CCTGCTTCTCCCCATCCCCACAG No data
Right 1161994402 19:7703640-7703662 CCAGGTGACATCCCCCTCTTAGG No data
1161994386_1161994393 -3 Left 1161994386 19:7703596-7703618 CCTGCTTCTCCCCATCCCCACAG No data
Right 1161994393 19:7703616-7703638 CAGCTGCTCCCTCTTCCCCCTGG No data
1161994386_1161994403 22 Left 1161994386 19:7703596-7703618 CCTGCTTCTCCCCATCCCCACAG No data
Right 1161994403 19:7703641-7703663 CAGGTGACATCCCCCTCTTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161994386 Original CRISPR CTGTGGGGATGGGGAGAAGC AGG (reversed) Intergenic
No off target data available for this crispr