ID: 1161995708 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 19:7710162-7710184 |
| Sequence | GGTGCTCTCCAAAGAAGCGG GGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 3 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1161995708_1161995725 | 25 | Left | 1161995708 | 19:7710162-7710184 | CCCCCGCTTCTTTGGAGAGCACC | No data | ||
| Right | 1161995725 | 19:7710210-7710232 | CCTTCCTAGGAAGAAGCCCTCGG | No data | ||||
| 1161995708_1161995726 | 26 | Left | 1161995708 | 19:7710162-7710184 | CCCCCGCTTCTTTGGAGAGCACC | No data | ||
| Right | 1161995726 | 19:7710211-7710233 | CTTCCTAGGAAGAAGCCCTCGGG | No data | ||||
| 1161995708_1161995720 | 12 | Left | 1161995708 | 19:7710162-7710184 | CCCCCGCTTCTTTGGAGAGCACC | No data | ||
| Right | 1161995720 | 19:7710197-7710219 | CCACACTCCCCAGCCTTCCTAGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1161995708 | Original CRISPR | GGTGCTCTCCAAAGAAGCGG GGG (reversed) | Intergenic | ||