ID: 1161995715

View in Genome Browser
Species Human (GRCh38)
Location 19:7710183-7710205
Sequence GGAGTGTGGGGAAGTCCCCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161995715_1161995725 4 Left 1161995715 19:7710183-7710205 CCCTGGGGACTTCCCCACACTCC No data
Right 1161995725 19:7710210-7710232 CCTTCCTAGGAAGAAGCCCTCGG No data
1161995715_1161995728 13 Left 1161995715 19:7710183-7710205 CCCTGGGGACTTCCCCACACTCC No data
Right 1161995728 19:7710219-7710241 GAAGAAGCCCTCGGGATCTGAGG No data
1161995715_1161995735 25 Left 1161995715 19:7710183-7710205 CCCTGGGGACTTCCCCACACTCC No data
Right 1161995735 19:7710231-7710253 GGGATCTGAGGGGGTTTCCTGGG No data
1161995715_1161995726 5 Left 1161995715 19:7710183-7710205 CCCTGGGGACTTCCCCACACTCC No data
Right 1161995726 19:7710211-7710233 CTTCCTAGGAAGAAGCCCTCGGG No data
1161995715_1161995720 -9 Left 1161995715 19:7710183-7710205 CCCTGGGGACTTCCCCACACTCC No data
Right 1161995720 19:7710197-7710219 CCACACTCCCCAGCCTTCCTAGG No data
1161995715_1161995729 14 Left 1161995715 19:7710183-7710205 CCCTGGGGACTTCCCCACACTCC No data
Right 1161995729 19:7710220-7710242 AAGAAGCCCTCGGGATCTGAGGG No data
1161995715_1161995731 16 Left 1161995715 19:7710183-7710205 CCCTGGGGACTTCCCCACACTCC No data
Right 1161995731 19:7710222-7710244 GAAGCCCTCGGGATCTGAGGGGG No data
1161995715_1161995734 24 Left 1161995715 19:7710183-7710205 CCCTGGGGACTTCCCCACACTCC No data
Right 1161995734 19:7710230-7710252 CGGGATCTGAGGGGGTTTCCTGG No data
1161995715_1161995730 15 Left 1161995715 19:7710183-7710205 CCCTGGGGACTTCCCCACACTCC No data
Right 1161995730 19:7710221-7710243 AGAAGCCCTCGGGATCTGAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161995715 Original CRISPR GGAGTGTGGGGAAGTCCCCA GGG (reversed) Intergenic