ID: 1161995716

View in Genome Browser
Species Human (GRCh38)
Location 19:7710184-7710206
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161995716_1161995734 23 Left 1161995716 19:7710184-7710206 CCTGGGGACTTCCCCACACTCCC No data
Right 1161995734 19:7710230-7710252 CGGGATCTGAGGGGGTTTCCTGG No data
1161995716_1161995735 24 Left 1161995716 19:7710184-7710206 CCTGGGGACTTCCCCACACTCCC No data
Right 1161995735 19:7710231-7710253 GGGATCTGAGGGGGTTTCCTGGG No data
1161995716_1161995726 4 Left 1161995716 19:7710184-7710206 CCTGGGGACTTCCCCACACTCCC No data
Right 1161995726 19:7710211-7710233 CTTCCTAGGAAGAAGCCCTCGGG No data
1161995716_1161995720 -10 Left 1161995716 19:7710184-7710206 CCTGGGGACTTCCCCACACTCCC No data
Right 1161995720 19:7710197-7710219 CCACACTCCCCAGCCTTCCTAGG No data
1161995716_1161995729 13 Left 1161995716 19:7710184-7710206 CCTGGGGACTTCCCCACACTCCC No data
Right 1161995729 19:7710220-7710242 AAGAAGCCCTCGGGATCTGAGGG No data
1161995716_1161995725 3 Left 1161995716 19:7710184-7710206 CCTGGGGACTTCCCCACACTCCC No data
Right 1161995725 19:7710210-7710232 CCTTCCTAGGAAGAAGCCCTCGG No data
1161995716_1161995731 15 Left 1161995716 19:7710184-7710206 CCTGGGGACTTCCCCACACTCCC No data
Right 1161995731 19:7710222-7710244 GAAGCCCTCGGGATCTGAGGGGG No data
1161995716_1161995728 12 Left 1161995716 19:7710184-7710206 CCTGGGGACTTCCCCACACTCCC No data
Right 1161995728 19:7710219-7710241 GAAGAAGCCCTCGGGATCTGAGG No data
1161995716_1161995736 30 Left 1161995716 19:7710184-7710206 CCTGGGGACTTCCCCACACTCCC No data
Right 1161995736 19:7710237-7710259 TGAGGGGGTTTCCTGGGATCAGG No data
1161995716_1161995730 14 Left 1161995716 19:7710184-7710206 CCTGGGGACTTCCCCACACTCCC No data
Right 1161995730 19:7710221-7710243 AGAAGCCCTCGGGATCTGAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161995716 Original CRISPR GGGAGTGTGGGGAAGTCCCC AGG (reversed) Intergenic