ID: 1161995717

View in Genome Browser
Species Human (GRCh38)
Location 19:7710195-7710217
Sequence TAGGAAGGCTGGGGAGTGTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 15 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161995717_1161995735 13 Left 1161995717 19:7710195-7710217 CCCCACACTCCCCAGCCTTCCTA No data
Right 1161995735 19:7710231-7710253 GGGATCTGAGGGGGTTTCCTGGG No data
1161995717_1161995738 21 Left 1161995717 19:7710195-7710217 CCCCACACTCCCCAGCCTTCCTA No data
Right 1161995738 19:7710239-7710261 AGGGGGTTTCCTGGGATCAGGGG No data
1161995717_1161995729 2 Left 1161995717 19:7710195-7710217 CCCCACACTCCCCAGCCTTCCTA No data
Right 1161995729 19:7710220-7710242 AAGAAGCCCTCGGGATCTGAGGG No data
1161995717_1161995726 -7 Left 1161995717 19:7710195-7710217 CCCCACACTCCCCAGCCTTCCTA No data
Right 1161995726 19:7710211-7710233 CTTCCTAGGAAGAAGCCCTCGGG No data
1161995717_1161995740 27 Left 1161995717 19:7710195-7710217 CCCCACACTCCCCAGCCTTCCTA No data
Right 1161995740 19:7710245-7710267 TTTCCTGGGATCAGGGGGAGAGG No data
1161995717_1161995728 1 Left 1161995717 19:7710195-7710217 CCCCACACTCCCCAGCCTTCCTA No data
Right 1161995728 19:7710219-7710241 GAAGAAGCCCTCGGGATCTGAGG No data
1161995717_1161995739 22 Left 1161995717 19:7710195-7710217 CCCCACACTCCCCAGCCTTCCTA No data
Right 1161995739 19:7710240-7710262 GGGGGTTTCCTGGGATCAGGGGG No data
1161995717_1161995725 -8 Left 1161995717 19:7710195-7710217 CCCCACACTCCCCAGCCTTCCTA No data
Right 1161995725 19:7710210-7710232 CCTTCCTAGGAAGAAGCCCTCGG No data
1161995717_1161995736 19 Left 1161995717 19:7710195-7710217 CCCCACACTCCCCAGCCTTCCTA No data
Right 1161995736 19:7710237-7710259 TGAGGGGGTTTCCTGGGATCAGG No data
1161995717_1161995730 3 Left 1161995717 19:7710195-7710217 CCCCACACTCCCCAGCCTTCCTA No data
Right 1161995730 19:7710221-7710243 AGAAGCCCTCGGGATCTGAGGGG No data
1161995717_1161995742 29 Left 1161995717 19:7710195-7710217 CCCCACACTCCCCAGCCTTCCTA No data
Right 1161995742 19:7710247-7710269 TCCTGGGATCAGGGGGAGAGGGG No data
1161995717_1161995741 28 Left 1161995717 19:7710195-7710217 CCCCACACTCCCCAGCCTTCCTA No data
Right 1161995741 19:7710246-7710268 TTCCTGGGATCAGGGGGAGAGGG No data
1161995717_1161995737 20 Left 1161995717 19:7710195-7710217 CCCCACACTCCCCAGCCTTCCTA No data
Right 1161995737 19:7710238-7710260 GAGGGGGTTTCCTGGGATCAGGG No data
1161995717_1161995731 4 Left 1161995717 19:7710195-7710217 CCCCACACTCCCCAGCCTTCCTA No data
Right 1161995731 19:7710222-7710244 GAAGCCCTCGGGATCTGAGGGGG No data
1161995717_1161995734 12 Left 1161995717 19:7710195-7710217 CCCCACACTCCCCAGCCTTCCTA No data
Right 1161995734 19:7710230-7710252 CGGGATCTGAGGGGGTTTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161995717 Original CRISPR TAGGAAGGCTGGGGAGTGTG GGG (reversed) Intergenic
No off target data available for this crispr