ID: 1161995719

View in Genome Browser
Species Human (GRCh38)
Location 19:7710197-7710219
Sequence CCTAGGAAGGCTGGGGAGTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 16 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161995719_1161995735 11 Left 1161995719 19:7710197-7710219 CCACACTCCCCAGCCTTCCTAGG No data
Right 1161995735 19:7710231-7710253 GGGATCTGAGGGGGTTTCCTGGG No data
1161995719_1161995731 2 Left 1161995719 19:7710197-7710219 CCACACTCCCCAGCCTTCCTAGG No data
Right 1161995731 19:7710222-7710244 GAAGCCCTCGGGATCTGAGGGGG No data
1161995719_1161995737 18 Left 1161995719 19:7710197-7710219 CCACACTCCCCAGCCTTCCTAGG No data
Right 1161995737 19:7710238-7710260 GAGGGGGTTTCCTGGGATCAGGG No data
1161995719_1161995729 0 Left 1161995719 19:7710197-7710219 CCACACTCCCCAGCCTTCCTAGG No data
Right 1161995729 19:7710220-7710242 AAGAAGCCCTCGGGATCTGAGGG No data
1161995719_1161995736 17 Left 1161995719 19:7710197-7710219 CCACACTCCCCAGCCTTCCTAGG No data
Right 1161995736 19:7710237-7710259 TGAGGGGGTTTCCTGGGATCAGG No data
1161995719_1161995742 27 Left 1161995719 19:7710197-7710219 CCACACTCCCCAGCCTTCCTAGG No data
Right 1161995742 19:7710247-7710269 TCCTGGGATCAGGGGGAGAGGGG No data
1161995719_1161995728 -1 Left 1161995719 19:7710197-7710219 CCACACTCCCCAGCCTTCCTAGG No data
Right 1161995728 19:7710219-7710241 GAAGAAGCCCTCGGGATCTGAGG No data
1161995719_1161995740 25 Left 1161995719 19:7710197-7710219 CCACACTCCCCAGCCTTCCTAGG No data
Right 1161995740 19:7710245-7710267 TTTCCTGGGATCAGGGGGAGAGG No data
1161995719_1161995744 30 Left 1161995719 19:7710197-7710219 CCACACTCCCCAGCCTTCCTAGG No data
Right 1161995744 19:7710250-7710272 TGGGATCAGGGGGAGAGGGGTGG No data
1161995719_1161995734 10 Left 1161995719 19:7710197-7710219 CCACACTCCCCAGCCTTCCTAGG No data
Right 1161995734 19:7710230-7710252 CGGGATCTGAGGGGGTTTCCTGG No data
1161995719_1161995738 19 Left 1161995719 19:7710197-7710219 CCACACTCCCCAGCCTTCCTAGG No data
Right 1161995738 19:7710239-7710261 AGGGGGTTTCCTGGGATCAGGGG No data
1161995719_1161995741 26 Left 1161995719 19:7710197-7710219 CCACACTCCCCAGCCTTCCTAGG No data
Right 1161995741 19:7710246-7710268 TTCCTGGGATCAGGGGGAGAGGG No data
1161995719_1161995730 1 Left 1161995719 19:7710197-7710219 CCACACTCCCCAGCCTTCCTAGG No data
Right 1161995730 19:7710221-7710243 AGAAGCCCTCGGGATCTGAGGGG No data
1161995719_1161995725 -10 Left 1161995719 19:7710197-7710219 CCACACTCCCCAGCCTTCCTAGG No data
Right 1161995725 19:7710210-7710232 CCTTCCTAGGAAGAAGCCCTCGG No data
1161995719_1161995739 20 Left 1161995719 19:7710197-7710219 CCACACTCCCCAGCCTTCCTAGG No data
Right 1161995739 19:7710240-7710262 GGGGGTTTCCTGGGATCAGGGGG No data
1161995719_1161995726 -9 Left 1161995719 19:7710197-7710219 CCACACTCCCCAGCCTTCCTAGG No data
Right 1161995726 19:7710211-7710233 CTTCCTAGGAAGAAGCCCTCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161995719 Original CRISPR CCTAGGAAGGCTGGGGAGTG TGG (reversed) Intergenic