ID: 1161995721

View in Genome Browser
Species Human (GRCh38)
Location 19:7710204-7710226
Sequence GCTTCTTCCTAGGAAGGCTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 16 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161995721_1161995730 -6 Left 1161995721 19:7710204-7710226 CCCCAGCCTTCCTAGGAAGAAGC No data
Right 1161995730 19:7710221-7710243 AGAAGCCCTCGGGATCTGAGGGG No data
1161995721_1161995737 11 Left 1161995721 19:7710204-7710226 CCCCAGCCTTCCTAGGAAGAAGC No data
Right 1161995737 19:7710238-7710260 GAGGGGGTTTCCTGGGATCAGGG No data
1161995721_1161995736 10 Left 1161995721 19:7710204-7710226 CCCCAGCCTTCCTAGGAAGAAGC No data
Right 1161995736 19:7710237-7710259 TGAGGGGGTTTCCTGGGATCAGG No data
1161995721_1161995740 18 Left 1161995721 19:7710204-7710226 CCCCAGCCTTCCTAGGAAGAAGC No data
Right 1161995740 19:7710245-7710267 TTTCCTGGGATCAGGGGGAGAGG No data
1161995721_1161995742 20 Left 1161995721 19:7710204-7710226 CCCCAGCCTTCCTAGGAAGAAGC No data
Right 1161995742 19:7710247-7710269 TCCTGGGATCAGGGGGAGAGGGG No data
1161995721_1161995744 23 Left 1161995721 19:7710204-7710226 CCCCAGCCTTCCTAGGAAGAAGC No data
Right 1161995744 19:7710250-7710272 TGGGATCAGGGGGAGAGGGGTGG No data
1161995721_1161995746 27 Left 1161995721 19:7710204-7710226 CCCCAGCCTTCCTAGGAAGAAGC No data
Right 1161995746 19:7710254-7710276 ATCAGGGGGAGAGGGGTGGGAGG No data
1161995721_1161995734 3 Left 1161995721 19:7710204-7710226 CCCCAGCCTTCCTAGGAAGAAGC No data
Right 1161995734 19:7710230-7710252 CGGGATCTGAGGGGGTTTCCTGG No data
1161995721_1161995728 -8 Left 1161995721 19:7710204-7710226 CCCCAGCCTTCCTAGGAAGAAGC No data
Right 1161995728 19:7710219-7710241 GAAGAAGCCCTCGGGATCTGAGG No data
1161995721_1161995739 13 Left 1161995721 19:7710204-7710226 CCCCAGCCTTCCTAGGAAGAAGC No data
Right 1161995739 19:7710240-7710262 GGGGGTTTCCTGGGATCAGGGGG No data
1161995721_1161995729 -7 Left 1161995721 19:7710204-7710226 CCCCAGCCTTCCTAGGAAGAAGC No data
Right 1161995729 19:7710220-7710242 AAGAAGCCCTCGGGATCTGAGGG No data
1161995721_1161995735 4 Left 1161995721 19:7710204-7710226 CCCCAGCCTTCCTAGGAAGAAGC No data
Right 1161995735 19:7710231-7710253 GGGATCTGAGGGGGTTTCCTGGG No data
1161995721_1161995745 24 Left 1161995721 19:7710204-7710226 CCCCAGCCTTCCTAGGAAGAAGC No data
Right 1161995745 19:7710251-7710273 GGGATCAGGGGGAGAGGGGTGGG No data
1161995721_1161995741 19 Left 1161995721 19:7710204-7710226 CCCCAGCCTTCCTAGGAAGAAGC No data
Right 1161995741 19:7710246-7710268 TTCCTGGGATCAGGGGGAGAGGG No data
1161995721_1161995731 -5 Left 1161995721 19:7710204-7710226 CCCCAGCCTTCCTAGGAAGAAGC No data
Right 1161995731 19:7710222-7710244 GAAGCCCTCGGGATCTGAGGGGG No data
1161995721_1161995738 12 Left 1161995721 19:7710204-7710226 CCCCAGCCTTCCTAGGAAGAAGC No data
Right 1161995738 19:7710239-7710261 AGGGGGTTTCCTGGGATCAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161995721 Original CRISPR GCTTCTTCCTAGGAAGGCTG GGG (reversed) Intergenic