ID: 1161995725

View in Genome Browser
Species Human (GRCh38)
Location 19:7710210-7710232
Sequence CCTTCCTAGGAAGAAGCCCT CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161995716_1161995725 3 Left 1161995716 19:7710184-7710206 CCTGGGGACTTCCCCACACTCCC No data
Right 1161995725 19:7710210-7710232 CCTTCCTAGGAAGAAGCCCTCGG No data
1161995715_1161995725 4 Left 1161995715 19:7710183-7710205 CCCTGGGGACTTCCCCACACTCC No data
Right 1161995725 19:7710210-7710232 CCTTCCTAGGAAGAAGCCCTCGG No data
1161995711_1161995725 22 Left 1161995711 19:7710165-7710187 CCGCTTCTTTGGAGAGCACCCTG No data
Right 1161995725 19:7710210-7710232 CCTTCCTAGGAAGAAGCCCTCGG No data
1161995709_1161995725 24 Left 1161995709 19:7710163-7710185 CCCCGCTTCTTTGGAGAGCACCC No data
Right 1161995725 19:7710210-7710232 CCTTCCTAGGAAGAAGCCCTCGG No data
1161995718_1161995725 -9 Left 1161995718 19:7710196-7710218 CCCACACTCCCCAGCCTTCCTAG No data
Right 1161995725 19:7710210-7710232 CCTTCCTAGGAAGAAGCCCTCGG No data
1161995708_1161995725 25 Left 1161995708 19:7710162-7710184 CCCCCGCTTCTTTGGAGAGCACC No data
Right 1161995725 19:7710210-7710232 CCTTCCTAGGAAGAAGCCCTCGG No data
1161995710_1161995725 23 Left 1161995710 19:7710164-7710186 CCCGCTTCTTTGGAGAGCACCCT No data
Right 1161995725 19:7710210-7710232 CCTTCCTAGGAAGAAGCCCTCGG No data
1161995719_1161995725 -10 Left 1161995719 19:7710197-7710219 CCACACTCCCCAGCCTTCCTAGG No data
Right 1161995725 19:7710210-7710232 CCTTCCTAGGAAGAAGCCCTCGG No data
1161995717_1161995725 -8 Left 1161995717 19:7710195-7710217 CCCCACACTCCCCAGCCTTCCTA No data
Right 1161995725 19:7710210-7710232 CCTTCCTAGGAAGAAGCCCTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161995725 Original CRISPR CCTTCCTAGGAAGAAGCCCT CGG Intergenic
No off target data available for this crispr