ID: 1161995728

View in Genome Browser
Species Human (GRCh38)
Location 19:7710219-7710241
Sequence GAAGAAGCCCTCGGGATCTG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161995716_1161995728 12 Left 1161995716 19:7710184-7710206 CCTGGGGACTTCCCCACACTCCC No data
Right 1161995728 19:7710219-7710241 GAAGAAGCCCTCGGGATCTGAGG No data
1161995722_1161995728 -9 Left 1161995722 19:7710205-7710227 CCCAGCCTTCCTAGGAAGAAGCC No data
Right 1161995728 19:7710219-7710241 GAAGAAGCCCTCGGGATCTGAGG No data
1161995723_1161995728 -10 Left 1161995723 19:7710206-7710228 CCAGCCTTCCTAGGAAGAAGCCC No data
Right 1161995728 19:7710219-7710241 GAAGAAGCCCTCGGGATCTGAGG No data
1161995718_1161995728 0 Left 1161995718 19:7710196-7710218 CCCACACTCCCCAGCCTTCCTAG No data
Right 1161995728 19:7710219-7710241 GAAGAAGCCCTCGGGATCTGAGG No data
1161995719_1161995728 -1 Left 1161995719 19:7710197-7710219 CCACACTCCCCAGCCTTCCTAGG No data
Right 1161995728 19:7710219-7710241 GAAGAAGCCCTCGGGATCTGAGG No data
1161995717_1161995728 1 Left 1161995717 19:7710195-7710217 CCCCACACTCCCCAGCCTTCCTA No data
Right 1161995728 19:7710219-7710241 GAAGAAGCCCTCGGGATCTGAGG No data
1161995715_1161995728 13 Left 1161995715 19:7710183-7710205 CCCTGGGGACTTCCCCACACTCC No data
Right 1161995728 19:7710219-7710241 GAAGAAGCCCTCGGGATCTGAGG No data
1161995721_1161995728 -8 Left 1161995721 19:7710204-7710226 CCCCAGCCTTCCTAGGAAGAAGC No data
Right 1161995728 19:7710219-7710241 GAAGAAGCCCTCGGGATCTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161995728 Original CRISPR GAAGAAGCCCTCGGGATCTG AGG Intergenic