ID: 1161995732

View in Genome Browser
Species Human (GRCh38)
Location 19:7710226-7710248
Sequence GAAACCCCCTCAGATCCCGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161995732_1161995738 -10 Left 1161995732 19:7710226-7710248 CCCTCGGGATCTGAGGGGGTTTC No data
Right 1161995738 19:7710239-7710261 AGGGGGTTTCCTGGGATCAGGGG No data
1161995732_1161995745 2 Left 1161995732 19:7710226-7710248 CCCTCGGGATCTGAGGGGGTTTC No data
Right 1161995745 19:7710251-7710273 GGGATCAGGGGGAGAGGGGTGGG No data
1161995732_1161995744 1 Left 1161995732 19:7710226-7710248 CCCTCGGGATCTGAGGGGGTTTC No data
Right 1161995744 19:7710250-7710272 TGGGATCAGGGGGAGAGGGGTGG No data
1161995732_1161995746 5 Left 1161995732 19:7710226-7710248 CCCTCGGGATCTGAGGGGGTTTC No data
Right 1161995746 19:7710254-7710276 ATCAGGGGGAGAGGGGTGGGAGG No data
1161995732_1161995742 -2 Left 1161995732 19:7710226-7710248 CCCTCGGGATCTGAGGGGGTTTC No data
Right 1161995742 19:7710247-7710269 TCCTGGGATCAGGGGGAGAGGGG No data
1161995732_1161995741 -3 Left 1161995732 19:7710226-7710248 CCCTCGGGATCTGAGGGGGTTTC No data
Right 1161995741 19:7710246-7710268 TTCCTGGGATCAGGGGGAGAGGG No data
1161995732_1161995740 -4 Left 1161995732 19:7710226-7710248 CCCTCGGGATCTGAGGGGGTTTC No data
Right 1161995740 19:7710245-7710267 TTTCCTGGGATCAGGGGGAGAGG No data
1161995732_1161995739 -9 Left 1161995732 19:7710226-7710248 CCCTCGGGATCTGAGGGGGTTTC No data
Right 1161995739 19:7710240-7710262 GGGGGTTTCCTGGGATCAGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161995732 Original CRISPR GAAACCCCCTCAGATCCCGA GGG (reversed) Intergenic