ID: 1161995733

View in Genome Browser
Species Human (GRCh38)
Location 19:7710227-7710249
Sequence GGAAACCCCCTCAGATCCCG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161995733_1161995741 -4 Left 1161995733 19:7710227-7710249 CCTCGGGATCTGAGGGGGTTTCC No data
Right 1161995741 19:7710246-7710268 TTCCTGGGATCAGGGGGAGAGGG No data
1161995733_1161995742 -3 Left 1161995733 19:7710227-7710249 CCTCGGGATCTGAGGGGGTTTCC No data
Right 1161995742 19:7710247-7710269 TCCTGGGATCAGGGGGAGAGGGG No data
1161995733_1161995745 1 Left 1161995733 19:7710227-7710249 CCTCGGGATCTGAGGGGGTTTCC No data
Right 1161995745 19:7710251-7710273 GGGATCAGGGGGAGAGGGGTGGG No data
1161995733_1161995744 0 Left 1161995733 19:7710227-7710249 CCTCGGGATCTGAGGGGGTTTCC No data
Right 1161995744 19:7710250-7710272 TGGGATCAGGGGGAGAGGGGTGG No data
1161995733_1161995746 4 Left 1161995733 19:7710227-7710249 CCTCGGGATCTGAGGGGGTTTCC No data
Right 1161995746 19:7710254-7710276 ATCAGGGGGAGAGGGGTGGGAGG No data
1161995733_1161995740 -5 Left 1161995733 19:7710227-7710249 CCTCGGGATCTGAGGGGGTTTCC No data
Right 1161995740 19:7710245-7710267 TTTCCTGGGATCAGGGGGAGAGG No data
1161995733_1161995739 -10 Left 1161995733 19:7710227-7710249 CCTCGGGATCTGAGGGGGTTTCC No data
Right 1161995739 19:7710240-7710262 GGGGGTTTCCTGGGATCAGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161995733 Original CRISPR GGAAACCCCCTCAGATCCCG AGG (reversed) Intergenic