ID: 1161995737

View in Genome Browser
Species Human (GRCh38)
Location 19:7710238-7710260
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161995727_1161995737 1 Left 1161995727 19:7710214-7710236 CCTAGGAAGAAGCCCTCGGGATC No data
Right 1161995737 19:7710238-7710260 GAGGGGGTTTCCTGGGATCAGGG No data
1161995719_1161995737 18 Left 1161995719 19:7710197-7710219 CCACACTCCCCAGCCTTCCTAGG No data
Right 1161995737 19:7710238-7710260 GAGGGGGTTTCCTGGGATCAGGG No data
1161995717_1161995737 20 Left 1161995717 19:7710195-7710217 CCCCACACTCCCCAGCCTTCCTA No data
Right 1161995737 19:7710238-7710260 GAGGGGGTTTCCTGGGATCAGGG No data
1161995722_1161995737 10 Left 1161995722 19:7710205-7710227 CCCAGCCTTCCTAGGAAGAAGCC No data
Right 1161995737 19:7710238-7710260 GAGGGGGTTTCCTGGGATCAGGG No data
1161995721_1161995737 11 Left 1161995721 19:7710204-7710226 CCCCAGCCTTCCTAGGAAGAAGC No data
Right 1161995737 19:7710238-7710260 GAGGGGGTTTCCTGGGATCAGGG No data
1161995723_1161995737 9 Left 1161995723 19:7710206-7710228 CCAGCCTTCCTAGGAAGAAGCCC No data
Right 1161995737 19:7710238-7710260 GAGGGGGTTTCCTGGGATCAGGG No data
1161995718_1161995737 19 Left 1161995718 19:7710196-7710218 CCCACACTCCCCAGCCTTCCTAG No data
Right 1161995737 19:7710238-7710260 GAGGGGGTTTCCTGGGATCAGGG No data
1161995724_1161995737 5 Left 1161995724 19:7710210-7710232 CCTTCCTAGGAAGAAGCCCTCGG No data
Right 1161995737 19:7710238-7710260 GAGGGGGTTTCCTGGGATCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161995737 Original CRISPR GAGGGGGTTTCCTGGGATCA GGG Intergenic