ID: 1161995742

View in Genome Browser
Species Human (GRCh38)
Location 19:7710247-7710269
Sequence TCCTGGGATCAGGGGGAGAG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161995722_1161995742 19 Left 1161995722 19:7710205-7710227 CCCAGCCTTCCTAGGAAGAAGCC No data
Right 1161995742 19:7710247-7710269 TCCTGGGATCAGGGGGAGAGGGG No data
1161995723_1161995742 18 Left 1161995723 19:7710206-7710228 CCAGCCTTCCTAGGAAGAAGCCC No data
Right 1161995742 19:7710247-7710269 TCCTGGGATCAGGGGGAGAGGGG No data
1161995718_1161995742 28 Left 1161995718 19:7710196-7710218 CCCACACTCCCCAGCCTTCCTAG No data
Right 1161995742 19:7710247-7710269 TCCTGGGATCAGGGGGAGAGGGG No data
1161995719_1161995742 27 Left 1161995719 19:7710197-7710219 CCACACTCCCCAGCCTTCCTAGG No data
Right 1161995742 19:7710247-7710269 TCCTGGGATCAGGGGGAGAGGGG No data
1161995727_1161995742 10 Left 1161995727 19:7710214-7710236 CCTAGGAAGAAGCCCTCGGGATC No data
Right 1161995742 19:7710247-7710269 TCCTGGGATCAGGGGGAGAGGGG No data
1161995733_1161995742 -3 Left 1161995733 19:7710227-7710249 CCTCGGGATCTGAGGGGGTTTCC No data
Right 1161995742 19:7710247-7710269 TCCTGGGATCAGGGGGAGAGGGG No data
1161995721_1161995742 20 Left 1161995721 19:7710204-7710226 CCCCAGCCTTCCTAGGAAGAAGC No data
Right 1161995742 19:7710247-7710269 TCCTGGGATCAGGGGGAGAGGGG No data
1161995717_1161995742 29 Left 1161995717 19:7710195-7710217 CCCCACACTCCCCAGCCTTCCTA No data
Right 1161995742 19:7710247-7710269 TCCTGGGATCAGGGGGAGAGGGG No data
1161995724_1161995742 14 Left 1161995724 19:7710210-7710232 CCTTCCTAGGAAGAAGCCCTCGG No data
Right 1161995742 19:7710247-7710269 TCCTGGGATCAGGGGGAGAGGGG No data
1161995732_1161995742 -2 Left 1161995732 19:7710226-7710248 CCCTCGGGATCTGAGGGGGTTTC No data
Right 1161995742 19:7710247-7710269 TCCTGGGATCAGGGGGAGAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161995742 Original CRISPR TCCTGGGATCAGGGGGAGAG GGG Intergenic
No off target data available for this crispr