ID: 1161995746

View in Genome Browser
Species Human (GRCh38)
Location 19:7710254-7710276
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161995733_1161995746 4 Left 1161995733 19:7710227-7710249 CCTCGGGATCTGAGGGGGTTTCC No data
Right 1161995746 19:7710254-7710276 ATCAGGGGGAGAGGGGTGGGAGG No data
1161995732_1161995746 5 Left 1161995732 19:7710226-7710248 CCCTCGGGATCTGAGGGGGTTTC No data
Right 1161995746 19:7710254-7710276 ATCAGGGGGAGAGGGGTGGGAGG No data
1161995723_1161995746 25 Left 1161995723 19:7710206-7710228 CCAGCCTTCCTAGGAAGAAGCCC No data
Right 1161995746 19:7710254-7710276 ATCAGGGGGAGAGGGGTGGGAGG No data
1161995721_1161995746 27 Left 1161995721 19:7710204-7710226 CCCCAGCCTTCCTAGGAAGAAGC No data
Right 1161995746 19:7710254-7710276 ATCAGGGGGAGAGGGGTGGGAGG No data
1161995727_1161995746 17 Left 1161995727 19:7710214-7710236 CCTAGGAAGAAGCCCTCGGGATC No data
Right 1161995746 19:7710254-7710276 ATCAGGGGGAGAGGGGTGGGAGG No data
1161995722_1161995746 26 Left 1161995722 19:7710205-7710227 CCCAGCCTTCCTAGGAAGAAGCC No data
Right 1161995746 19:7710254-7710276 ATCAGGGGGAGAGGGGTGGGAGG No data
1161995724_1161995746 21 Left 1161995724 19:7710210-7710232 CCTTCCTAGGAAGAAGCCCTCGG No data
Right 1161995746 19:7710254-7710276 ATCAGGGGGAGAGGGGTGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161995746 Original CRISPR ATCAGGGGGAGAGGGGTGGG AGG Intergenic