ID: 1162001109

View in Genome Browser
Species Human (GRCh38)
Location 19:7745665-7745687
Sequence CCTTCAGCCGGGTCAGCTCC TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 221
Summary {0: 6, 1: 6, 2: 1, 3: 18, 4: 190}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1162001103_1162001109 16 Left 1162001103 19:7745626-7745648 CCTGCTGCTTAGATTTCTCTGGA 0: 3
1: 2
2: 4
3: 26
4: 246
Right 1162001109 19:7745665-7745687 CCTTCAGCCGGGTCAGCTCCTGG 0: 6
1: 6
2: 1
3: 18
4: 190
1162001101_1162001109 28 Left 1162001101 19:7745614-7745636 CCTGGTAGATCTCCTGCTGCTTA 0: 3
1: 2
2: 9
3: 7
4: 126
Right 1162001109 19:7745665-7745687 CCTTCAGCCGGGTCAGCTCCTGG 0: 6
1: 6
2: 1
3: 18
4: 190

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162001109 Original CRISPR CCTTCAGCCGGGTCAGCTCC TGG Exonic