ID: 1162003537

View in Genome Browser
Species Human (GRCh38)
Location 19:7763445-7763467
Sequence TCTTGTGGCCATGTATCTGC TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 137
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 124}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1162003537_1162003539 -9 Left 1162003537 19:7763445-7763467 CCAGCAGATACATGGCCACAAGA 0: 1
1: 0
2: 1
3: 11
4: 124
Right 1162003539 19:7763459-7763481 GCCACAAGAGCTCTACAGGTAGG 0: 1
1: 0
2: 0
3: 6
4: 75
1162003537_1162003542 3 Left 1162003537 19:7763445-7763467 CCAGCAGATACATGGCCACAAGA 0: 1
1: 0
2: 1
3: 11
4: 124
Right 1162003542 19:7763471-7763493 CTACAGGTAGGCAAGAGTTAGGG 0: 1
1: 0
2: 0
3: 8
4: 119
1162003537_1162003543 15 Left 1162003537 19:7763445-7763467 CCAGCAGATACATGGCCACAAGA 0: 1
1: 0
2: 1
3: 11
4: 124
Right 1162003543 19:7763483-7763505 AAGAGTTAGGGAGCAGATAGTGG 0: 1
1: 0
2: 3
3: 32
4: 281
1162003537_1162003541 2 Left 1162003537 19:7763445-7763467 CCAGCAGATACATGGCCACAAGA 0: 1
1: 0
2: 1
3: 11
4: 124
Right 1162003541 19:7763470-7763492 TCTACAGGTAGGCAAGAGTTAGG 0: 1
1: 0
2: 0
3: 8
4: 107

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162003537 Original CRISPR TCTTGTGGCCATGTATCTGC TGG (reversed) Exonic
901937887 1:12639536-12639558 TAATGTGTTCATGTATCTGCTGG + Intergenic
902891744 1:19449103-19449125 TTTTGTGGCAATGGAACTGCTGG - Intronic
910083063 1:83364740-83364762 TTTCTTGGCCATGTGTCTGCAGG - Intergenic
910893582 1:92043690-92043712 TCCTGTGCTCATGGATCTGCAGG + Intronic
916064331 1:161123914-161123936 TCTTGTAGACAAGTATCTGGAGG - Exonic
917560272 1:176144719-176144741 TCATGTGTCCATGTATGTGTGGG - Intronic
920428459 1:205898056-205898078 TGTGGTGGCCATGTATCTAGTGG + Intergenic
921159906 1:212465363-212465385 CCCAGTGGCCATGTCTCTGCAGG + Intergenic
923833197 1:237580591-237580613 TTTGGTGGACATGTGTCTGCTGG + Intronic
924074412 1:240318417-240318439 TTTTTTTTCCATGTATCTGCTGG + Intronic
924566334 1:245201786-245201808 TCATTTTGCCATGTTTCTGCAGG + Intronic
1063333266 10:5183964-5183986 TTTTGTGGGCATGTATATGGTGG + Intergenic
1065700872 10:28424118-28424140 TTTTGTGGCCCTGTGTCTTCAGG + Intergenic
1066991301 10:42516731-42516753 AGTTGTGGCTATGTGTCTGCTGG - Intergenic
1068318778 10:55382698-55382720 TCCTGTGGCCATGAGTCTACTGG + Intronic
1070547492 10:77464029-77464051 TCTTGTGGCAATGTATATTCGGG - Intronic
1070848762 10:79545780-79545802 TCTTGTGGGAATGTTCCTGCAGG - Intergenic
1071796123 10:89008181-89008203 TTCTGTGTCCTTGTATCTGCAGG - Intronic
1073453827 10:103624777-103624799 TCTCTTGGCCATGTGGCTGCAGG + Intronic
1075055093 10:119212297-119212319 CCTTGTGGGCATTTATCTGATGG - Intronic
1075283543 10:121162408-121162430 TCTTGAGAACATGTAGCTGCTGG + Intergenic
1076493981 10:130884903-130884925 TCTTGTGGCCATGACTTTTCAGG - Intergenic
1077024899 11:434771-434793 TCTCGTGTCCCTGTGTCTGCTGG - Intronic
1081466554 11:43324397-43324419 TCCTGAGGCCATGCATCTTCTGG + Intronic
1081778132 11:45691028-45691050 GCCTGTGGCCCTGTATCTGAGGG - Intergenic
1082093490 11:48108378-48108400 GCTTCTGGCCATGTAACTGCGGG - Intronic
1093172048 12:15872380-15872402 TCTTGTGGAAATGTTTCTGTAGG + Intronic
1093241016 12:16674625-16674647 TCTTGTATCCATGTCTCTGCGGG - Intergenic
1093387174 12:18571157-18571179 TCTTGTGGCCATGGATTTTTAGG + Intronic
1099115214 12:78615681-78615703 TCTGGTGGCCAAGGATCTTCTGG - Intergenic
1103337209 12:120198782-120198804 TTTAGTGGCCATGGATCTGCTGG - Intronic
1104321879 12:127759290-127759312 TCTTGTTGCACTGTATCTGGAGG - Intergenic
1107990675 13:45816297-45816319 CCTTGAGGCCCTGTTTCTGCTGG + Intronic
1109865722 13:68260728-68260750 TCATGTAGCCCGGTATCTGCTGG + Intergenic
1111924012 13:94443558-94443580 TCCTGAGGCCAGGCATCTGCAGG + Exonic
1113411323 13:110092942-110092964 TCATGTGGCCATGTGAATGCAGG - Intergenic
1113576054 13:111396101-111396123 TTCTGAGGCCATGCATCTGCTGG + Intergenic
1113594847 13:111523888-111523910 TCTTGAGGACCTGTATCTGCAGG - Intergenic
1123171878 14:106380436-106380458 TCTTGTGAACATGTATCTATTGG + Intergenic
1130005308 15:80090806-80090828 TCTAGGAGCCATGTATCTTCAGG + Intronic
1130629769 15:85555083-85555105 TCTTGTGGCCCTGGGTATGCAGG + Intronic
1131791978 15:95975019-95975041 TCTTATGGCCATGAAGCTTCAGG + Intergenic
1135831205 16:25775263-25775285 TGTTGTTGGCATGTGTCTGCAGG + Intronic
1137249039 16:46729687-46729709 CCGTGTGGCTATGTCTCTGCAGG - Exonic
1139237470 16:65355341-65355363 TCTTGTGGTCATTTTTCTGCAGG + Intergenic
1139488426 16:67272198-67272220 TCTTGTGTCCATGTGTCAGGGGG + Intergenic
1140731571 16:77861340-77861362 TGTTGTGGTCATGTATATTCAGG - Intronic
1144438008 17:15258633-15258655 TCTTGTGTCCATGTAACTGACGG + Intronic
1146017669 17:29246938-29246960 TCTCCTGGGCATGTCTCTGCAGG - Intronic
1146073990 17:29711074-29711096 TCATGTGGCCCAGTCTCTGCTGG - Intronic
1147955807 17:44133740-44133762 TCTAGGAGCCATGTTTCTGCTGG - Intergenic
1149373009 17:56014399-56014421 TCTTGTCGCCATTGCTCTGCTGG + Intergenic
1150205429 17:63401822-63401844 TTTTGGGGCCATGTATTTCCAGG - Intronic
1150461140 17:65354373-65354395 TCTTTTGACCATGTTTCTACTGG - Intergenic
1153983707 18:10334407-10334429 TCTTGCAGCCAGGTAGCTGCTGG - Intergenic
1155269329 18:24124173-24124195 TTTTGAGGCCCTGTATCTGCAGG - Intronic
1156036197 18:32770447-32770469 CCTTGTGGCAATGGAACTGCTGG + Exonic
1156094200 18:33509983-33510005 TCTTGTAGCCATGAATGTGCAGG - Intergenic
1158546850 18:58404415-58404437 TCTGCTGGCCGTGTCTCTGCTGG - Intergenic
1160816360 19:1037765-1037787 ACTTGGGGTCATATATCTGCCGG - Exonic
1161718637 19:5891566-5891588 TCTTGGAGCCTTGTCTCTGCTGG + Exonic
1162003537 19:7763445-7763467 TCTTGTGGCCATGTATCTGCTGG - Exonic
1165733168 19:38159274-38159296 TCTTGGGCCCATGTTCCTGCTGG - Intronic
1166176909 19:41080384-41080406 TCTTTTTGCAATGTATTTGCTGG + Intergenic
1166381357 19:42356882-42356904 CCGTGGTGCCATGTATCTGCTGG + Exonic
925935477 2:8754507-8754529 TCTTTGGGCCATTTAACTGCTGG - Intronic
926524225 2:13956650-13956672 TCTTGTGGCCATATATTCTCTGG + Intergenic
927621210 2:24661332-24661354 TCTTTTGCCCATGTTCCTGCTGG + Intronic
929228673 2:39537262-39537284 TCTCATGGCCTTGTATCTGGGGG + Intergenic
931115062 2:59156750-59156772 ACTTCAGGCCATTTATCTGCAGG - Intergenic
936624448 2:114133344-114133366 TCTGGTGGCAATACATCTGCAGG + Intergenic
938787394 2:134644441-134644463 TCATATGGCCATATTTCTGCGGG - Intronic
940194315 2:151076449-151076471 TCTTTTGGCCATTTGTCTTCAGG - Intergenic
942669536 2:178359544-178359566 TCTTCTGGGCATATATCTACAGG + Intronic
947361479 2:229349795-229349817 TTTTGTGGACATGTACCTGGTGG - Intergenic
947715720 2:232338017-232338039 TCCTGGAGCCAAGTATCTGCAGG + Intronic
947721254 2:232370394-232370416 TCCTGGAGCCAAGTATCTGCAGG + Intergenic
947734749 2:232448777-232448799 TCCTGGAGCCAAGTATCTGCAGG + Intergenic
1169987956 20:11468094-11468116 TCTTTTTGCAATGTATTTGCTGG + Intergenic
1172006842 20:31823678-31823700 CCATGTGGCCATGTCTCAGCGGG - Intronic
1173373888 20:42465315-42465337 ACTTGTGGCAATGTATCTTTAGG - Intronic
1174064139 20:47852609-47852631 TCCTGTGGCCATGTATGTGCTGG + Intergenic
1175966388 20:62662007-62662029 TCTTGTGCCCTTGTAGCAGCAGG + Intronic
1176953457 21:15072447-15072469 AGCTGTGGCCATGTAACTGCTGG - Intergenic
1178111385 21:29373350-29373372 GCTTCTGGCCATTTAGCTGCTGG - Intronic
1183041393 22:35181229-35181251 TTCTGTGTCCTTGTATCTGCAGG - Intergenic
950833424 3:15897500-15897522 TCTTGTGGCCCTGTAAGTTCAGG - Intergenic
951071440 3:18333405-18333427 TCTTATAGTCATGAATCTGCAGG + Intronic
953807730 3:46085909-46085931 TGTTGTGCCCAAGAATCTGCTGG - Intergenic
955010200 3:55006419-55006441 TGTTGTGTCTTTGTATCTGCTGG - Intronic
960840277 3:121951111-121951133 TCTTGAGGACTTGTGTCTGCTGG + Intergenic
972587524 4:40451473-40451495 TCATGTGTCCATGTAGCAGCGGG - Intronic
973695790 4:53489450-53489472 TCTTGAGTCCCTGAATCTGCTGG + Intronic
973895643 4:55410010-55410032 TGTAGTTGCCATGTATTTGCAGG + Intronic
975218306 4:71782792-71782814 TCTTTTGGCCAAGGATTTGCTGG - Intronic
975877334 4:78857284-78857306 TCATGTGGGAATATATCTGCTGG - Intronic
981480244 4:145231100-145231122 TGTAGTGGCCATCTCTCTGCGGG - Intergenic
985170638 4:187145999-187146021 TCCAGTGCCCATGAATCTGCTGG - Intergenic
989704470 5:44312018-44312040 CCTTCTGTCCATGTATCTGTAGG + Intronic
996959099 5:129222731-129222753 TCATGTGGCCATGTGCCTGATGG + Intergenic
997515497 5:134486087-134486109 TCTTTTGCCCATTTTTCTGCTGG - Intergenic
998443763 5:142182869-142182891 TTTTGTGAGCATGTATTTGCCGG - Intergenic
1000654665 5:163861813-163861835 TCTTGTATCCCTGCATCTGCAGG + Intergenic
1001432650 5:171675113-171675135 TCTTCTGGCAGTGTCTCTGCAGG + Intergenic
1003556747 6:7146535-7146557 TCTTGTGGCCATAAATGTGGAGG + Intronic
1004202235 6:13559622-13559644 TCTGGTGGCCATCTTTCTGGTGG - Intergenic
1005527973 6:26670649-26670671 TCATGTGTACATGCATCTGCGGG - Intergenic
1007778162 6:44235425-44235447 TCTTGTGGCCATGTGTGGGATGG - Intergenic
1010391645 6:75344690-75344712 TCATGTGGCCCTGTAAATGCTGG - Intronic
1010895329 6:81356034-81356056 CCTTGTGGCCATGTAGATGATGG - Intergenic
1012280519 6:97322457-97322479 TCTGATGGCCTAGTATCTGCTGG + Intergenic
1013512703 6:110859022-110859044 ACTTGGGGTCATGTATCTGCCGG - Intronic
1018895626 6:168014561-168014583 TTTTGTGACCTTGTATCTCCTGG + Intronic
1019110722 6:169710363-169710385 TCCTCTGGCAATGTATCTGAAGG - Exonic
1021025778 7:15665216-15665238 TATTCTGGCAATGTATCTGGAGG - Intronic
1022137411 7:27462099-27462121 TCTTGTAGACAAGGATCTGCTGG + Intergenic
1027299896 7:76820940-76820962 TTTCTTGGCCATGTGTCTGCAGG - Intergenic
1032484931 7:132278503-132278525 TTTTGTGGCCATGCATGGGCTGG - Intronic
1033436030 7:141334475-141334497 ACTTGCAGTCATGTATCTGCAGG + Intronic
1035568232 8:656028-656050 TCTTGAGGCCATGAGTCTGCAGG - Intronic
1036518796 8:9471129-9471151 TCTTGGAGCATTGTATCTGCAGG - Intergenic
1039271431 8:35885087-35885109 TCTCTTGGCCATGTTTCTACAGG - Intergenic
1047898658 8:129396180-129396202 GCCTGTAGCCATGTAACTGCTGG - Intergenic
1048250422 8:132862495-132862517 TCATGTGGCCTTGTTACTGCTGG + Intergenic
1049341597 8:142115356-142115378 TCTTGTGGCCAGAGAGCTGCAGG - Intergenic
1049403222 8:142440154-142440176 ACTTGTGGCTATGTACCTTCAGG + Intergenic
1052942387 9:34139905-34139927 TTTTGTGGCCATGTCTATGTTGG - Intergenic
1053797759 9:41741634-41741656 TTTTGTGGGCATGTATATGGTGG - Intergenic
1054186172 9:61953687-61953709 TTTTGTGGGCATGTATATGGTGG - Intergenic
1054467177 9:65504361-65504383 TTTTGTGGGCATGTATATGGTGG + Intergenic
1054652331 9:67634836-67634858 TTTTGTGGGCATGTATATGGTGG + Intergenic
1059014681 9:110503173-110503195 TGATGTGGCCATGTTTCGGCTGG + Exonic
1187117537 X:16367974-16367996 TCTTGTGCATATGTATCTGTAGG + Intergenic
1187398034 X:18934967-18934989 TCCTGTGGCCATGTGTGTGTGGG + Intronic
1190451295 X:50583727-50583749 TCTTGTGGCCATAGAGCTGAGGG - Intergenic
1192102576 X:68279847-68279869 TCATGTGGCAAAGTATCAGCAGG + Intronic
1192217462 X:69172275-69172297 TCTTTTGTCCATGTTTCTACTGG + Intergenic