ID: 1162003988

View in Genome Browser
Species Human (GRCh38)
Location 19:7765436-7765458
Sequence CAGGAGAGGGAGGAGGAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 6696
Summary {0: 1, 1: 6, 2: 167, 3: 1205, 4: 5317}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1162003976_1162003988 -1 Left 1162003976 19:7765414-7765436 CCCTCCCCACTCTAGAGCAGGAC 0: 1
1: 1
2: 0
3: 20
4: 184
Right 1162003988 19:7765436-7765458 CAGGAGAGGGAGGAGGAGGAGGG 0: 1
1: 6
2: 167
3: 1205
4: 5317
1162003979_1162003988 -5 Left 1162003979 19:7765418-7765440 CCCCACTCTAGAGCAGGACAGGA 0: 1
1: 1
2: 0
3: 12
4: 141
Right 1162003988 19:7765436-7765458 CAGGAGAGGGAGGAGGAGGAGGG 0: 1
1: 6
2: 167
3: 1205
4: 5317
1162003972_1162003988 7 Left 1162003972 19:7765406-7765428 CCCACAGCCCCTCCCCACTCTAG 0: 2
1: 0
2: 5
3: 65
4: 427
Right 1162003988 19:7765436-7765458 CAGGAGAGGGAGGAGGAGGAGGG 0: 1
1: 6
2: 167
3: 1205
4: 5317
1162003975_1162003988 0 Left 1162003975 19:7765413-7765435 CCCCTCCCCACTCTAGAGCAGGA 0: 1
1: 1
2: 0
3: 21
4: 270
Right 1162003988 19:7765436-7765458 CAGGAGAGGGAGGAGGAGGAGGG 0: 1
1: 6
2: 167
3: 1205
4: 5317
1162003973_1162003988 6 Left 1162003973 19:7765407-7765429 CCACAGCCCCTCCCCACTCTAGA 0: 1
1: 3
2: 6
3: 67
4: 538
Right 1162003988 19:7765436-7765458 CAGGAGAGGGAGGAGGAGGAGGG 0: 1
1: 6
2: 167
3: 1205
4: 5317
1162003971_1162003988 12 Left 1162003971 19:7765401-7765423 CCTCTCCCACAGCCCCTCCCCAC 0: 2
1: 4
2: 30
3: 353
4: 2933
Right 1162003988 19:7765436-7765458 CAGGAGAGGGAGGAGGAGGAGGG 0: 1
1: 6
2: 167
3: 1205
4: 5317
1162003980_1162003988 -6 Left 1162003980 19:7765419-7765441 CCCACTCTAGAGCAGGACAGGAG 0: 1
1: 1
2: 0
3: 21
4: 147
Right 1162003988 19:7765436-7765458 CAGGAGAGGGAGGAGGAGGAGGG 0: 1
1: 6
2: 167
3: 1205
4: 5317
1162003977_1162003988 -2 Left 1162003977 19:7765415-7765437 CCTCCCCACTCTAGAGCAGGACA 0: 1
1: 1
2: 1
3: 18
4: 149
Right 1162003988 19:7765436-7765458 CAGGAGAGGGAGGAGGAGGAGGG 0: 1
1: 6
2: 167
3: 1205
4: 5317
1162003970_1162003988 30 Left 1162003970 19:7765383-7765405 CCTGGGGGTCTGTAGGGGCCTCT 0: 2
1: 0
2: 2
3: 23
4: 205
Right 1162003988 19:7765436-7765458 CAGGAGAGGGAGGAGGAGGAGGG 0: 1
1: 6
2: 167
3: 1205
4: 5317
1162003981_1162003988 -7 Left 1162003981 19:7765420-7765442 CCACTCTAGAGCAGGACAGGAGA 0: 1
1: 1
2: 0
3: 17
4: 169
Right 1162003988 19:7765436-7765458 CAGGAGAGGGAGGAGGAGGAGGG 0: 1
1: 6
2: 167
3: 1205
4: 5317

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162003988 Original CRISPR CAGGAGAGGGAGGAGGAGGA GGG Intronic
Too many off-targets to display for this crispr