ID: 1162004066

View in Genome Browser
Species Human (GRCh38)
Location 19:7765969-7765991
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 221
Summary {0: 6, 1: 6, 2: 1, 3: 18, 4: 190}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1162004066_1162004072 16 Left 1162004066 19:7765969-7765991 CCAGGAGCTGACCCGGCTGAAGG 0: 6
1: 6
2: 1
3: 18
4: 190
Right 1162004072 19:7766008-7766030 GCCAGAGAAATCCAAGCTGCAGG 0: 5
1: 0
2: 8
3: 23
4: 266
1162004066_1162004075 28 Left 1162004066 19:7765969-7765991 CCAGGAGCTGACCCGGCTGAAGG 0: 6
1: 6
2: 1
3: 18
4: 190
Right 1162004075 19:7766020-7766042 CAAGCTGCAGGAGATCTACCAGG 0: 7
1: 2
2: 4
3: 22
4: 132

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162004066 Original CRISPR CCTTCAGCCGGGTCAGCTCC TGG (reversed) Exonic
900132552 1:1093532-1093554 GCTGCAGTCTGGTCAGCTCCTGG - Intronic
900216051 1:1482244-1482266 CCTTCAGGCGGATCTGCTCGCGG - Exonic
900223171 1:1520247-1520269 CCTTCAGGCGGATCTGCTCGCGG - Exonic
900327512 1:2116044-2116066 CCGGGAGCCGGGACAGCTCCAGG - Intronic
900371292 1:2333311-2333333 CCAGCAGCCGGGTCAGCCCCGGG + Intronic
900385830 1:2410254-2410276 ACCTCACCCGGGCCAGCTCCAGG + Intronic
900552084 1:3261863-3261885 CCTGCAGCCTGTGCAGCTCCTGG + Intronic
900824375 1:4914292-4914314 CCTCCAGCAGGGGCAGCTCTGGG - Intergenic
901807179 1:11745887-11745909 GTGTCAGCCGGGTCAGGTCCTGG + Intronic
902286187 1:15410043-15410065 CGTTCAGCCCGGGCTGCTCCGGG - Exonic
902385625 1:16073790-16073812 CCTTCAGCCCGGGCAACCCCAGG - Intergenic
902610381 1:17593627-17593649 GTTTCAGCAGGGGCAGCTCCAGG - Intronic
902629642 1:17697026-17697048 CCTTCTTGCGGGTCAGCTCTCGG - Exonic
903306670 1:22417759-22417781 CCTTCAACCCGGTCTGCTCTTGG - Intergenic
904054966 1:27663965-27663987 CCCTCAGCCTTGTCAGATCCTGG - Intergenic
904381783 1:30116264-30116286 CCTTCAGCCGTGTCAGGACACGG + Intergenic
905480940 1:38261562-38261584 CCTGCAGCCCTGTCTGCTCCTGG - Intergenic
906639641 1:47433913-47433935 GCCTCAGCCGGTACAGCTCCCGG - Intergenic
907398945 1:54212577-54212599 CCTTCAACCAGATCAGCTGCGGG + Exonic
909565050 1:77044521-77044543 CCTTCAGCCGGGGCAGCACCTGG - Exonic
910276836 1:85458335-85458357 CCTTCAGCAGCATCAGCTTCAGG + Intronic
914198953 1:145467413-145467435 TCTTGAGCTGGGTCAGTTCCTGG + Intergenic
914377656 1:147086368-147086390 TCTTGAGCTGGGTCAGTTCCTGG + Intergenic
914502787 1:148262274-148262296 TCTTGAGCTGGGTCAGTTCCTGG - Intergenic
914511516 1:148336385-148336407 TCTTGAGCTGGGTCAGTTCCTGG + Intergenic
917825975 1:178820881-178820903 CCTACAGCCAGGTAAGCCCCAGG - Intronic
920032923 1:203048295-203048317 CCCTCACCCGTGCCAGCTCCTGG - Intronic
922200165 1:223394258-223394280 TCTTGAGACGGGTCAGCACCAGG - Exonic
922470438 1:225873717-225873739 CCTCCTGCCAGGTCAGCGCCGGG - Intronic
923660371 1:235952024-235952046 TCTTCAGTCTGGTCAGCTCAGGG - Intergenic
924265633 1:242278988-242279010 CCTTCAGCCTTTTCATCTCCAGG - Intronic
1063077424 10:2731054-2731076 CCTCCAGGCTGGTCAGCCCCAGG + Intergenic
1066581340 10:36885931-36885953 CATTCAGCAGGGTCTGGTCCAGG - Intergenic
1072548295 10:96457328-96457350 CATTCAGCCAGGTGAGTTCCGGG - Intronic
1073141214 10:101249234-101249256 CCTCCGGCCAGCTCAGCTCCAGG - Intergenic
1074769191 10:116722509-116722531 CCTGTTGCAGGGTCAGCTCCTGG - Intronic
1075006724 10:118835923-118835945 CCTCCAGCCAGGACAGCACCTGG + Intergenic
1076715531 10:132362068-132362090 CCTTCACCTGGGTCAACGCCTGG - Intronic
1076915280 10:133420297-133420319 CCCACAGCCTGGCCAGCTCCAGG + Exonic
1077872131 11:6271108-6271130 CCGTCAGCGCCGTCAGCTCCAGG - Exonic
1078893784 11:15580172-15580194 TGTTCAGCTGAGTCAGCTCCTGG - Intergenic
1083656375 11:64231757-64231779 GTTTCAGCCCTGTCAGCTCCTGG + Intronic
1083797620 11:65026657-65026679 CCATCAGCCAGCTCAGCCCCTGG + Intronic
1085319713 11:75566419-75566441 CCTGCAGCCGCAGCAGCTCCTGG + Exonic
1085412292 11:76298401-76298423 CCTTCAGCCCATTCAGCGCCCGG - Intergenic
1085690213 11:78658276-78658298 CTCTCTGCCGGGCCAGCTCCAGG + Exonic
1086966370 11:93032215-93032237 CCTTCAGCCAGGTCATCTGATGG + Intergenic
1091280113 11:134376873-134376895 CCTTGACCCGGCTCAGCTGCTGG - Intronic
1092757103 12:11774035-11774057 CCCTCAGCCGGCTGAGCTCCAGG - Intronic
1093433347 12:19108030-19108052 CCTTGCGCTGGGCCAGCTCCGGG + Intergenic
1094493381 12:30975240-30975262 ACTTCAGCCGGGTGAGGTCATGG - Intronic
1096546610 12:52344498-52344520 CCTTCAGCAGTCTCAGCTTCTGG - Intergenic
1103577462 12:121888925-121888947 CCTTGCGCCGCATCAGCTCCTGG - Exonic
1103702719 12:122856090-122856112 CCCTCAGCTGGGCCAGCTCGTGG - Exonic
1103913198 12:124363174-124363196 CCACCAGCCTGGTCAGCTCAGGG + Intronic
1104898482 12:132175695-132175717 CCCTCAGCAGGCTCAGCTCTGGG - Intergenic
1113702376 13:112397000-112397022 CCTGCAGCCGGGTGGGCTACAGG - Intronic
1114665356 14:24374339-24374361 CCTCCACCTGGGGCAGCTCCTGG - Exonic
1115337370 14:32255226-32255248 CCTTCAGCCTGCTGAGCTCACGG + Intergenic
1117293814 14:54360712-54360734 CCTGCAGCAGGGACAGCACCAGG + Intergenic
1119330008 14:73786854-73786876 GCTGCAGCGGGGCCAGCTCCAGG - Intronic
1119636721 14:76279353-76279375 CCTTCAGCCATGTCCTCTCCTGG + Intergenic
1120698141 14:87667033-87667055 ACTTCACCCCGGTGAGCTCCAGG - Intergenic
1120940091 14:89939591-89939613 CCTTCAGCATGTCCAGCTCCAGG + Intronic
1122040446 14:98984099-98984121 CCTTCAGCCTGGTAAGCAGCAGG - Intergenic
1122649772 14:103220196-103220218 CCTCCAGCCAGGCCATCTCCAGG - Intergenic
1123047492 14:105526197-105526219 CCTACATCCCTGTCAGCTCCTGG + Intergenic
1202922117 14_KI270723v1_random:35774-35796 CCTGCAGCTGGATGAGCTCCTGG + Intergenic
1202922812 14_KI270724v1_random:1839-1861 CCTGCAGCTGGATGAGCTCCTGG - Intergenic
1129714205 15:77837514-77837536 CCGCCAGCCTGGTCAGGTCCAGG + Intergenic
1130738576 15:86574497-86574519 CCTTCAGATATGTCAGCTCCTGG - Intronic
1130996490 15:88907254-88907276 GGTTCAGGCGGGCCAGCTCCGGG + Exonic
1131514097 15:93066013-93066035 CCTTCAGCGGGGACAGAACCTGG - Intronic
1132620756 16:867395-867417 CCTTCCTCTGGGCCAGCTCCAGG + Intronic
1132653129 16:1030570-1030592 CCTTGAGCGGAGCCAGCTCCCGG + Intergenic
1132730395 16:1358144-1358166 CCTCCAGCCAGGCCAGCCCCAGG - Intronic
1133046338 16:3090344-3090366 CCTTCAGGCGAGACAGCTGCGGG + Exonic
1133170104 16:3977556-3977578 ACTTCTGCCAGCTCAGCTCCTGG - Exonic
1133319463 16:4903980-4904002 CCTTCTGCAGGGTCACGTCCCGG + Exonic
1134682551 16:16136558-16136580 CCTTCAGGTGGGCCAGCTCCAGG - Exonic
1136507202 16:30712282-30712304 GCTTCTGCGGGGCCAGCTCCGGG + Exonic
1138514506 16:57528694-57528716 CCCTCAGCCGCGCCAGCTCGCGG + Exonic
1139490285 16:67282290-67282312 GCTTCAGCCATGTCAGCTCCCGG - Exonic
1140974997 16:80051191-80051213 CCTTGAGACAGGACAGCTCCAGG - Intergenic
1142122968 16:88396403-88396425 CCTTCAGGAGGGTCTCCTCCTGG - Intergenic
1142123004 16:88396511-88396533 CCTTCAGACGGGTCTCCGCCTGG - Intergenic
1142123013 16:88396538-88396560 CCTTCAGGAGGGTCTCCTCCCGG - Intergenic
1142123040 16:88396619-88396641 CCTTCAGGAGGGTCTCCTCCCGG - Intergenic
1142123060 16:88396673-88396695 CCTTCAGACGGGTCTCCTCCCGG - Intergenic
1142123107 16:88396835-88396857 CCTTCAGGAGGGTCTCCTCCAGG - Intergenic
1142123136 16:88396916-88396938 CCTTCAGACGGGTCTCCTCCCGG - Intergenic
1142123152 16:88396970-88396992 CCTTCAGGAGGGTCTCCTCCTGG - Intergenic
1142123162 16:88396997-88397019 CCTTCAGGAGGGTCTCCTCCCGG - Intergenic
1142123179 16:88397051-88397073 CCTTCAGAAGGGTCTCCTCCCGG - Intergenic
1142591968 17:1010217-1010239 CCTTCAGCCTTCTCTGCTCCTGG - Intronic
1144557831 17:16297601-16297623 CCTTCAGCTGCGTGAGCTCAGGG + Intronic
1145795754 17:27654447-27654469 CCTTCAGCAGGCTAAGCTCTGGG + Intergenic
1146000657 17:29128399-29128421 CCTTCTGCTGTGGCAGCTCCCGG + Intronic
1146571036 17:33953644-33953666 CTTTCAGCCTGGTAAGATCCAGG + Intronic
1150769822 17:68031522-68031544 CTTTCAGCCAGCTCAGCTCCAGG + Intergenic
1150857106 17:68763827-68763849 CTTTCTGCTGGGTCAGCTGCAGG + Intergenic
1151495361 17:74455061-74455083 CCTTCAGCCCGGACAGCCCCTGG - Intergenic
1151745218 17:76008278-76008300 CCTCCAGCCGCGAGAGCTCCTGG + Exonic
1151952442 17:77362607-77362629 CCTTCAGCCTCGTCTGCCCCTGG - Intronic
1152099144 17:78290970-78290992 CCTGCTGCAGGGCCAGCTCCAGG + Intergenic
1152155346 17:78629281-78629303 CCTCCCGCCGGGCCAGCTGCTGG + Intergenic
1152381968 17:79946823-79946845 CCTGCACCGGGGACAGCTCCAGG - Intronic
1152416932 17:80168760-80168782 CCTTCAGCCGGCTCATCACCAGG + Intergenic
1154485970 18:14871431-14871453 CCATCAGCCTAGTAAGCTCCAGG - Intergenic
1155185491 18:23383487-23383509 CCTTCAGCCAGGACAGTTTCAGG + Intronic
1155540348 18:26863271-26863293 CCTTGGGCAGGCTCAGCTCCCGG - Intronic
1160983726 19:1828036-1828058 ACCTCAGCAGGGCCAGCTCCCGG - Exonic
1161448011 19:4328781-4328803 CCTCCAGCCGGCTCACCTTCAGG + Exonic
1161793821 19:6375425-6375447 CCTGCAGCCGGGCCAGCGCCAGG + Exonic
1162001090 19:7745527-7745549 CCTTCAGCTGGGTCAGCTCCTGG + Exonic
1162001099 19:7745596-7745618 CCTTCAGCCGGGTCAGCTCCTGG + Exonic
1162001109 19:7745665-7745687 CCTTCAGCCGGGTCAGCTCCTGG + Exonic
1162001117 19:7745734-7745756 CCTTCAGCCGAGTCAGCTCCTGG + Exonic
1162001126 19:7745803-7745825 CCTTCAGCCAGGTCAGCTCCTGG + Exonic
1162001136 19:7745872-7745894 CCTTCAGCCGGGTCAGCTCCTGG + Exonic
1162001146 19:7745941-7745963 CCTTCAGCTGGGTCAGCTCCTGG + Exonic
1162004033 19:7765762-7765784 CCTTCAGCTGGGTCAGCTCCTGG - Exonic
1162004044 19:7765831-7765853 CCTTCAGCCGGGTCAGCTCCTGG - Exonic
1162004055 19:7765900-7765922 CCTTCAGCCGGGTCAGCTCCTGG - Exonic
1162004066 19:7765969-7765991 CCTTCAGCCGGGTCAGCTCCTGG - Exonic
1162004077 19:7766038-7766060 CCTTCAGCTCCGTCAGCTCCTGG - Exonic
1162004085 19:7766107-7766129 CCTTCAGCTGGGTCAGCTCCTGG - Exonic
1162027005 19:7900115-7900137 CCTTGAGCTGCTTCAGCTCCCGG - Exonic
1162452306 19:10762618-10762640 CGTTCATCCGGGTCAGGTACTGG - Intronic
1165172917 19:33906281-33906303 CCTGCAGCTGGGGCAGCCCCGGG + Intergenic
1165412951 19:35673506-35673528 CCCAGAGGCGGGTCAGCTCCTGG - Exonic
1165778935 19:38420924-38420946 TCTGCAGCCGTCTCAGCTCCTGG + Exonic
1166256021 19:41605175-41605197 CCTCCACCCAGGTCAGCTCCAGG + Intronic
1167330726 19:48854249-48854271 TCTTCAGCCGGGTCCTCCCCTGG - Exonic
1168403477 19:56099048-56099070 CCTGCAGGCGGGACAGATCCAGG - Intronic
1168715023 19:58521933-58521955 CCTTCACCCAGGACAGCTACTGG + Intronic
929017078 2:37508500-37508522 CCTTCAGCTGGGGCAGTTCCTGG + Intergenic
932491686 2:72126913-72126935 CCCTCAGCTGGGCCAGCTCCCGG + Intergenic
934777334 2:96947806-96947828 CCTTCAGCCTGGTCAGTACTGGG - Exonic
935826920 2:106961586-106961608 CCTTCAGCTGTGTCAGTTCTCGG - Intergenic
936389169 2:112055846-112055868 GCCTCTGCCGGGTCAGCACCGGG + Intronic
936522081 2:113217789-113217811 CCGTCAGCCAGGCCAGCCCCAGG - Exonic
946690074 2:222302913-222302935 CCTTCAGCTGGGGGAGCCCCAGG + Intronic
948537131 2:238654687-238654709 CCCTCTGCCGGCTCAGCTGCCGG + Intergenic
948857160 2:240735511-240735533 CCCTCAGCCCAGGCAGCTCCTGG - Intronic
948895671 2:240925802-240925824 CCGTCATCCCGGCCAGCTCCCGG - Exonic
1172511350 20:35503340-35503362 CCTTCTGCAGCATCAGCTCCTGG - Exonic
1173504285 20:43574801-43574823 CGTACAGCAGGGTCAGCTCTTGG + Intronic
1174147694 20:48463564-48463586 CCTTCATCTGGGTCAGAGCCAGG + Intergenic
1174531677 20:51219417-51219439 CCTTGAGCAGGCTCAGCTTCAGG - Intergenic
1175813941 20:61873921-61873943 CGTGCAGGCGGGTGAGCTCCTGG + Intronic
1176022830 20:62970880-62970902 GCCTCTGCCAGGTCAGCTCCAGG + Intergenic
1176795334 21:13367947-13367969 CCATCAGCCTAGTAAGCTCCAGG + Intergenic
1178913911 21:36696611-36696633 CCTCCAGCAGGGAGAGCTCCGGG + Intergenic
1180414155 22:12693567-12693589 CCTTCTGCTGGATGAGCTCCTGG - Intergenic
1180879830 22:19195912-19195934 CCTTCTGCCCTGTCAGCTCAGGG - Intronic
1181175277 22:21031746-21031768 GCTTCAGGCGGTTCAGCTTCTGG + Exonic
1181343080 22:22198418-22198440 CCTGCACCCGGATCACCTCCAGG - Intergenic
1183386172 22:37516062-37516084 CCTTGAGCCGCAGCAGCTCCAGG + Exonic
1185385416 22:50529580-50529602 GCTTCATGCGGATCAGCTCCGGG + Exonic
949541119 3:5032811-5032833 CCTTACTCAGGGTCAGCTCCTGG + Intergenic
950207040 3:11088797-11088819 CCTTCCGCAGGCTCAGCACCAGG + Intergenic
953496850 3:43394717-43394739 CCTCCACCCGGGGCAGCTCAAGG - Intronic
953500058 3:43424587-43424609 TCTTCAGCTGAGTCAGTTCCTGG - Intronic
953679842 3:45030882-45030904 CCTTCAGCAGGGCCACCTCCTGG - Exonic
954218246 3:49136258-49136280 TCTTCTGCTGGGTCAGATCCAGG - Intergenic
954950213 3:54465842-54465864 CCTTCAGCCTTGTGAGATCCAGG - Intronic
966762168 3:183428279-183428301 CCTCCGGCCGGGCGAGCTCCGGG + Intronic
966931332 3:184677675-184677697 CCTCCAGCTGAGCCAGCTCCAGG + Intronic
967081863 3:186057161-186057183 CCTTCAGCTGTGGCAGTTCCTGG - Exonic
968120663 3:196123594-196123616 TCTTCTGCTGAGTCAGCTCCTGG - Intergenic
968629522 4:1642775-1642797 CCACCTGCCGGGTCACCTCCAGG + Intronic
968650871 4:1759802-1759824 CCGTGGGCGGGGTCAGCTCCTGG - Intergenic
968845958 4:3041681-3041703 CCCTCAGCAGGGTCAGCTCTGGG - Intergenic
969532915 4:7739685-7739707 CCTTGAGGCGGGGCAGCTCTGGG + Intronic
969606021 4:8202684-8202706 GCCTCAGCCGGATCAGCCCCGGG - Intronic
970579369 4:17460817-17460839 CCTGCAGCTGAGTCAGTTCCTGG + Intronic
982499935 4:156141160-156141182 AATTCAGCAGGCTCAGCTCCTGG + Intergenic
982753787 4:159194338-159194360 CCTTCAGGCAGATCAGGTCCTGG + Intronic
985578444 5:684418-684440 CATTCAGCCTGGACAGCTCTCGG + Intronic
987309214 5:16666695-16666717 CCAGCAGCCAGGGCAGCTCCAGG - Exonic
995183666 5:109250894-109250916 CCTTCTGCCGTGTCAGCGCACGG + Intergenic
1001979667 5:176030370-176030392 CCATCAGCCTAGTAAGCTCCAGG + Intronic
1002237750 5:177813393-177813415 CCATCAGCCTAGTAAGCTCCAGG - Intergenic
1002275905 5:178104391-178104413 CCGTCAACCTGGTAAGCTCCAGG + Intergenic
1002724710 5:181286779-181286801 CCATCAGCCTAGTAAGCTCCGGG - Intergenic
1003312372 6:4980803-4980825 TCTTCTGCTGGGTCAGTTCCTGG + Intergenic
1004829515 6:19462357-19462379 TCTTAGGCAGGGTCAGCTCCGGG + Intergenic
1006793320 6:36717399-36717421 ACTTCCTCAGGGTCAGCTCCAGG - Exonic
1007786979 6:44286200-44286222 CCTTCCGCCGGTGCAGCTCCCGG - Exonic
1014647686 6:123994635-123994657 GCTTCACCCAAGTCAGCTCCAGG + Intronic
1015328512 6:131951095-131951117 TCTGCAGCCGGGTAAGCGCCGGG - Exonic
1018148924 6:160920539-160920561 CCTGCAGCCTGACCAGCTCCTGG + Intergenic
1018706057 6:166463904-166463926 CCTACAGCCGGGTAAACTGCAGG - Intronic
1019145902 6:169975474-169975496 CCTTCAGAAATGTCAGCTCCGGG - Intergenic
1019476590 7:1247456-1247478 GCTGCAGTCGGGGCAGCTCCAGG + Intergenic
1019570439 7:1709019-1709041 CCTGCAGCCGTCTCAGCTGCTGG - Intronic
1021843380 7:24741455-24741477 CATTCAAAGGGGTCAGCTCCAGG + Intronic
1023418087 7:39950582-39950604 CCTCCTCCCGGGTCAGATCCTGG - Exonic
1023907309 7:44531754-44531776 CCTTGGGCAGGGCCAGCTCCTGG + Exonic
1024253584 7:47523679-47523701 CCTTCATCTGGGCCAGTTCCTGG + Intronic
1030060548 7:105617780-105617802 CTTTCAGCCAGGTCAGCATCTGG - Intronic
1030063479 7:105641392-105641414 CCAACAGCCTGCTCAGCTCCAGG - Intronic
1031688845 7:124764681-124764703 CCTGCAGCCGGGTCACGGCCCGG + Exonic
1032440678 7:131940824-131940846 CCTTGAGCCAGGGCATCTCCTGG - Intergenic
1035255904 7:157627174-157627196 CCTGCAGCTGGGTCTCCTCCGGG + Intronic
1038439879 8:27564357-27564379 CATTCAGCCAGGGCAGCACCAGG + Intergenic
1049277607 8:141727778-141727800 CCTTCACCCCTGTGAGCTCCGGG - Intergenic
1049283251 8:141761235-141761257 CCTTCCTCCTGGGCAGCTCCCGG + Intergenic
1052122780 9:24738636-24738658 CCTCCAGCCGTGCCGGCTCCAGG + Intergenic
1052574840 9:30279318-30279340 CCTTCTGCCTGGTGAGCTTCAGG - Intergenic
1053886887 9:42650252-42650274 CCATCAGCCTAGTAAGCTCCGGG - Intergenic
1054225906 9:62457702-62457724 CCATCAGCCTAGTAAGCTCCGGG - Intergenic
1060395320 9:123312540-123312562 CCTTCAGCCTGGACAGTTCAGGG - Intergenic
1185791280 X:2929392-2929414 CCTTCATCCGCGTCATCTCCTGG + Intergenic
1188797617 X:34484595-34484617 CCTCCAGCCACCTCAGCTCCAGG - Intergenic
1190566115 X:51732085-51732107 CCTGAAGCCTGGTCATCTCCGGG - Intergenic
1190828983 X:54043909-54043931 CCGGCAGCCGGGCTAGCTCCGGG + Intronic
1192359575 X:70430655-70430677 GGTTCAGCTGGGTCAGCTTCTGG - Intronic
1199682522 X:150236865-150236887 CCTTCAACCTGGTCTGCTCAGGG - Intergenic
1200129193 X:153831659-153831681 CCTGCAGCCGGGGCAGCCTCTGG - Intergenic