ID: 1162007761

View in Genome Browser
Species Human (GRCh38)
Location 19:7790724-7790746
Sequence TGGTTCTCAGCAGTGGTGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1162007761_1162007767 2 Left 1162007761 19:7790724-7790746 CCATCCACCACTGCTGAGAACCA No data
Right 1162007767 19:7790749-7790771 CGGCCAGGCCCAGCCCTGTCCGG No data
1162007761_1162007773 16 Left 1162007761 19:7790724-7790746 CCATCCACCACTGCTGAGAACCA No data
Right 1162007773 19:7790763-7790785 CCTGTCCGGTGCCTGCACTCTGG No data
1162007761_1162007774 17 Left 1162007761 19:7790724-7790746 CCATCCACCACTGCTGAGAACCA No data
Right 1162007774 19:7790764-7790786 CTGTCCGGTGCCTGCACTCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162007761 Original CRISPR TGGTTCTCAGCAGTGGTGGA TGG (reversed) Intergenic
No off target data available for this crispr