ID: 1162009144

View in Genome Browser
Species Human (GRCh38)
Location 19:7801070-7801092
Sequence ACCCGTGGGTACCTGAAGTC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1162009141_1162009144 -9 Left 1162009141 19:7801056-7801078 CCAGCCTCAACACTACCCGTGGG No data
Right 1162009144 19:7801070-7801092 ACCCGTGGGTACCTGAAGTCCGG No data
1162009135_1162009144 17 Left 1162009135 19:7801030-7801052 CCACGTTGGGCGCCAGATGGTGG No data
Right 1162009144 19:7801070-7801092 ACCCGTGGGTACCTGAAGTCCGG No data
1162009139_1162009144 5 Left 1162009139 19:7801042-7801064 CCAGATGGTGGGGTCCAGCCTCA No data
Right 1162009144 19:7801070-7801092 ACCCGTGGGTACCTGAAGTCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162009144 Original CRISPR ACCCGTGGGTACCTGAAGTC CGG Intergenic
No off target data available for this crispr