ID: 1162009502

View in Genome Browser
Species Human (GRCh38)
Location 19:7803704-7803726
Sequence TCGACTTCCATCCCCCACCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1162009502_1162009504 -10 Left 1162009502 19:7803704-7803726 CCCAGGTGGGGGATGGAAGTCGA No data
Right 1162009504 19:7803717-7803739 TGGAAGTCGAAATGCGTACCTGG No data
1162009502_1162009508 15 Left 1162009502 19:7803704-7803726 CCCAGGTGGGGGATGGAAGTCGA No data
Right 1162009508 19:7803742-7803764 GCCTAACTGCTTGCTGAGCTGGG No data
1162009502_1162009505 -7 Left 1162009502 19:7803704-7803726 CCCAGGTGGGGGATGGAAGTCGA No data
Right 1162009505 19:7803720-7803742 AAGTCGAAATGCGTACCTGGTGG No data
1162009502_1162009507 14 Left 1162009502 19:7803704-7803726 CCCAGGTGGGGGATGGAAGTCGA No data
Right 1162009507 19:7803741-7803763 GGCCTAACTGCTTGCTGAGCTGG No data
1162009502_1162009510 23 Left 1162009502 19:7803704-7803726 CCCAGGTGGGGGATGGAAGTCGA No data
Right 1162009510 19:7803750-7803772 GCTTGCTGAGCTGGGTTAAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162009502 Original CRISPR TCGACTTCCATCCCCCACCT GGG (reversed) Intergenic