ID: 1162009503

View in Genome Browser
Species Human (GRCh38)
Location 19:7803705-7803727
Sequence TTCGACTTCCATCCCCCACC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1162009503_1162009510 22 Left 1162009503 19:7803705-7803727 CCAGGTGGGGGATGGAAGTCGAA No data
Right 1162009510 19:7803750-7803772 GCTTGCTGAGCTGGGTTAAGTGG No data
1162009503_1162009507 13 Left 1162009503 19:7803705-7803727 CCAGGTGGGGGATGGAAGTCGAA No data
Right 1162009507 19:7803741-7803763 GGCCTAACTGCTTGCTGAGCTGG No data
1162009503_1162009511 30 Left 1162009503 19:7803705-7803727 CCAGGTGGGGGATGGAAGTCGAA No data
Right 1162009511 19:7803758-7803780 AGCTGGGTTAAGTGGCAATTTGG No data
1162009503_1162009508 14 Left 1162009503 19:7803705-7803727 CCAGGTGGGGGATGGAAGTCGAA No data
Right 1162009508 19:7803742-7803764 GCCTAACTGCTTGCTGAGCTGGG No data
1162009503_1162009505 -8 Left 1162009503 19:7803705-7803727 CCAGGTGGGGGATGGAAGTCGAA No data
Right 1162009505 19:7803720-7803742 AAGTCGAAATGCGTACCTGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162009503 Original CRISPR TTCGACTTCCATCCCCCACC TGG (reversed) Intergenic