ID: 1162009505

View in Genome Browser
Species Human (GRCh38)
Location 19:7803720-7803742
Sequence AAGTCGAAATGCGTACCTGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1162009503_1162009505 -8 Left 1162009503 19:7803705-7803727 CCAGGTGGGGGATGGAAGTCGAA No data
Right 1162009505 19:7803720-7803742 AAGTCGAAATGCGTACCTGGTGG No data
1162009502_1162009505 -7 Left 1162009502 19:7803704-7803726 CCCAGGTGGGGGATGGAAGTCGA No data
Right 1162009505 19:7803720-7803742 AAGTCGAAATGCGTACCTGGTGG No data
1162009495_1162009505 26 Left 1162009495 19:7803671-7803693 CCTAGCTCAAAGAGTAACTAGCT No data
Right 1162009505 19:7803720-7803742 AAGTCGAAATGCGTACCTGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1162009505 Original CRISPR AAGTCGAAATGCGTACCTGG TGG Intergenic